Elattostachys xylocarpa

(A.Cunn. ex F.Muell.) Radlk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Elattostachys

At a glance

Occurrence records1 034

Data sources8

Biological traits36

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Elattostachys xylocarpa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 034 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF1 034 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Elattostachys xylocarpa, known as the white tamarind or short-leaf beetroot is a common rainforest tree of eastern Australia. Found in the drier rainforests, which are based on volcanic soils. From as far south as the Orara River in northern New South Wales to Bowen in tropical Queensland. The name Elattostachys refers to "little spikes", a flower feature of other plants in this genus. xylocarpa refers to the hard woody fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology15

Fruit length17.5 mm

Fruit width18.5 mm

Leaf length70 mm

Leaf length max150 mm

Leaf length min60 mm

Leaf mass per area100 g/m2

Leaf size2 104 mm²

⚠ sources differ — TRY: 2 104 mm² · AusTraits: 2 411 mm²

Leaf width27.5 mm

Leaf width max40 mm

Leaf width min15 mm

Petiole length3 cm

Plant height17.5 m

Plant height max10 m

Seed length7 mm

Seed width3.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timeyyyyyynnnnyy

Life formtree

Life spanperennial

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesscompound

Leaf shapeelliptical oblong obovate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)9.84 mm²/mg

Wood density663 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elattostachys xylocarpa has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895922.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Elattostachys xylocarpa voucher 129308281 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type1 034 records

Wild obs. + sensor448

Museum / vouchered255

Cultivated / captive2

Other329

Origin

Native28

Introduced1

Range

Area of Occupancy AOO2 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 210≤1 km 13≤10 km 14>10 km 14

251 georeferenced · 197 without coordinates

Open the mapobservation + sensor448

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 63≤1 km 29≤10 km 76>10 km 36

204 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence255

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	121
Mount Annan, AU	30
Canberra, AU	26
Museo Entomologico de Leonlocation not on record	22
Armidale, AU	18
Smithfield, AU	13
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	3
James Cook Townsvillelocation not on record	3
Kew, GB	2
University of Stellenboschlocation not on record	1
Glocation not on record	1
Adelaide, AU	1

12 institutions · 241 of 255 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Elattostachys xylocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 17.4–21.6

Seasonal swing summer↔winter11.1 °C

Max temp (day)24.0 °C 22.1–24.9

Min temp (night)14.2 °C 13.2–18.9

Precipitation80.2 mm/mo 72.6–100

Air humidity59.9 % 57.4–60.8

Moisture balance-48.8 mm/mo -82.8–-14.4

Vapour deficit987 Pa 804–1,054

Wind speed2.90 m/s 2.90–5.10

Cloud cover25.0 % 24.0–27.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elattostachys xylocarpa

At a glance

Sources8 archives

Size & morphology15

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Other traits1

At a glance

Record type1 034 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 034 records