Elatostema umbellatum

(Siebold & Zucc.) Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Elatostema

At a glance

Occurrence records274

Data sources8

Biological traits4

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Elatostema umbellatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF274 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 52

01Narrative

Elatostema umbellatum is a species of flowering plant in the nettle family (Urticaceae). It is native to Japan, where it is found from the Kantō region westward.Elatostema japonicum (in Japanese), Flora of Mikawa Its natural habitat is in moist, deeply forested places in the mountains. It is a perennial, growing 20 to 30 cm tall. It has serrated leaves, 3 to 6 cm long, with up to 5 teeth per side. It produces umbels of small flowers in from March to May.Elatostema japonicum Prof. Summer's Web Garden It is similar to the wider-ranging and more robust Elatostema involucratum, which has been considered a variety of Elatostema umbellatum by some authors (as E. umbellatum var. majus).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial or subshrub

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elatostema umbellatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC617131.1 ↗553 bpJapan · 2013

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAACCAAAGATACTGATATCTTAGCAGC …

Elatostema umbellatum var. majus P3332 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Elatostema umbellatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 521×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kanemoto, T. & N. Naruhashi. 2003. Chromosome numbers of Japanese Pellionia (Urticaceae). J. Jap. Bot. 78: 262–268.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type274 records

Wild obs. + sensor2

Museum / vouchered272

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 272 records without

Open the institutions mapphysical evidence272

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	82
Sanda, JP	66
Nagatoro-machi, Chichibu-gun, JP	36
KOMlocation not on record	31
Chiba, JP	15
Toyota city nature sanctuarylocation not on record	10
Universidad Católica de Santa Maríalocation not on record	7
Guangzhou, CN	6
KURAlocation not on record	4
Sagamihara, JP	3
Yangling, CN	2
Nanjing, CN	2
Bronx, US	1
Xian, CN	1
Awka, NG	1
Wellington, NZ	1
Siouxland Heritage Museumlocation not on record	1
Shanghai, CN	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1
Fort Worth, US	1

20 institutions · 272 of 272 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Elatostema umbellatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)