Elatostema stipitatum

Wedd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Elatostema

At a glance

Occurrence records231

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Elatostema stipitatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility231 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF231 records

DNA & barcodingNCBIsequences

01Narrative

Elatostema stipitatum is a flowering plant in the nettle family. Often seen along rainforest streams or moist areas in eastern Australia, north from the Comboyne area of New South Wales to the Sunshine Coast area of Queensland. Leaves 1 to 6 cm long, 1 to 2.5 cm wide with a point, the base of the leaf may be asymmetric, leaves hairy with a toothed edge, the leaf stem may be absent, or 2 mm long. The plant can form mats and cover a large area.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology10

Fruit length1.5 mm

Fruit width1 mm

Leaf length40 mm

Leaf length max60 mm

Leaf length min10 mm

Leaf width17.5 mm

Leaf width max25 mm

Leaf width min10 mm

Petiole length0.2 cm

Plant height max0.3 m

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical obovate ovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elatostema stipitatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLAY208709.1 ↗936 bp

ACGT

AACCCCGGGACGAGAAGTAGTAGGATTTATTCTCATAAAAAAAGAAAAATATGTCGAAATTTTTTTTTATTTTAATTATTGAAATCAATA …

Elatostema stipitatum chloroplast atpB-rbcL intergenic spacer, partial sequence; and ribulose-1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type231 records

Wild obs. + sensor133

Museum / vouchered93

Cultivated / captive2

Other3

Origin

Native24

Introduced1

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 95≤1 km 9≤10 km 9

113 georeferenced · 20 without coordinates

Open the mapobservation + sensor133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 20≤1 km 11≤10 km 27>10 km 6

64 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence93

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	26
Mount Annan, AU	25
Canberra, AU	16
Museo Entomologico de Leonlocation not on record	11
Armidale, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Smithfield, AU	3
Kew, GB	1
Saint Louis, US	1

9 institutions · 93 of 93 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)