Elatostema rugosum

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Elatostema

At a glance

Occurrence records1 512

Data sources10

Biological traits2

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Elatostema rugosum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 512 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 512 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

01Narrative

Elatostema rugosum, commonly known as parataniwha or New Zealand begonia is a herbaceous ground cover plant that is endemic to New Zealand. Elatostema rugosum grows up to 1 m high in wet, shaded places such as gullies and streamsides. It has long green-purple leaves with prominent veins and a saw-like edge. The common name parataniwha, roughly translates to "home of the taniwha" and suggests the presence of a taniwha, a powerful supernatural being in Māori mythology.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial or subshrub

Habitat & environment1

Climatesubtropical

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elatostema rugosum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKT626700.1 ↗1 263 bpNew Zealand · 1991

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAACCAAAGATACTGATATCTTAGCAGC …

Elatostema rugosum voucher CHR:472985 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Elatostema rugosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Tree of Sex Database · CCDB · new-zealand · CCDB · ipcn-api-dl +1

GoaT · Tree of Sex Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 512 records

Wild obs. + sensor1 374

Museum / vouchered137

Cultivated / captive1

Origin

Native8

Introduced1

Range

Area of Occupancy AOO2 600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 869≤1 km 215≤10 km 74>10 km 27

1 185 georeferenced · 189 without coordinates

Open the mapobservation + sensor1 374

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 2≤10 km 15>10 km 1

21 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence137

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	56
Wellington, NZ	46
Christchurch, NZ	10
Mount Annan, AU	9
Rotorua, NZ	7
Museo Entomologico de Leonlocation not on record	3
Moscow State Universitylocation not on record	1
Hobart, AU	1
Chicago, US	1
Armidale, AU	1
Saint Louis, US	1

11 institutions · 136 of 137 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elatostema rugosum

At a glance

Sources10 archives

Life cycle & reproduction1

Habitat & environment1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 512 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 11 geolocated

Cultivated / Captivenot free-living

Record type1 512 records