Elatostema reticulatum

Wedd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Elatostema

At a glance

Occurrence records1 127

Data sources7

Biological traits30

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Elatostema reticulatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF1 127 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Elatostema reticulatum is a flowering plant in the nettle family. A lush herbaceous plant with thick soft stems. Growing to 50 cm high, and often seen along rainforest streams. Flowering occurs in summer. Found in eastern Australia from Batemans Bay in the south to tropical Queensland in the north. The specific epithet alludes to the reticulated veiny leaves. Joan Cribb suggests the stems and young leaves are edible, and taste better than spinach.Les Robinson - Field Guide to the Native Plants of Sydney, page 381

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Fruit length1.5 mm

Fruit width1 mm

Leaf length125 mm

Leaf length max150 mm

Leaf length min70 mm

Leaf width45 mm

Leaf width max60 mm

Leaf width min20 mm

Petiole length0.4 cm

Plant height0.5 m

⚠ sources differ — GIFT: 0.5 m · AusTraits: 1 m

Plant height max0.5 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeyyyynnnnnnyy

Life formperennial or subshrub

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_ovate obovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elatostema reticulatum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes6

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP858834.1 ↗935 bpAustralia

ACGT

ACCTGCGGAAGGATCATTGTCGAGTCTTGCTAAAGTAGAATGACAAGCGAACATGTTCTTTTACAAAACGTTACGATGTCGTCGAACTCT …

Elatostema reticulatum voucher K:P. I. Forster 7564 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 127 records

Wild obs. + sensor783

Museum / vouchered326

Cultivated / captive4

Other14

Origin

Native94

Range

Area of Occupancy AOO2 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 538≤1 km 80≤10 km 54>10 km 14

686 georeferenced · 97 without coordinates

Open the mapobservation + sensor783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 54≤1 km 68≤10 km 114>10 km 28

264 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence326

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	94
Brisbane, AU	65
Canberra, AU	53
Museo Entomologico de Leonlocation not on record	36
Smithfield, AU	27
Armidale, AU	13
Wollongong, AU	9
Adelaide, AU	6
Kew, GB	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Hobart, AU	2
Batemans Bay, AU	2
IPA/SPlocation not on record	1
Auckland, NZ	1
South Kensington, GB	1
University of the Sunshine Coastlocation not on record	1
Australian Tropical Herbariumlocation not on record	1
Palmerston, AU	1

18 institutions · 320 of 326 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Elatostema reticulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.0–22.8

Seasonal swing summer↔winter9.40 °C

Max temp (day)28.2 °C 24.9–28.4

Min temp (night)17.5 °C 15.5–18.3

Precipitation60.7 mm/mo 24.6–102

Air humidity61.8 % 47.1–65.4

Moisture balance-103 mm/mo -135–-64.3

Vapour deficit1,072 Pa 876–1,514

Wind speed3.20 m/s 2.40–3.80

Cloud cover21.8 % 18.8–31.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elatostema reticulatum

At a glance

Sources7 archives

Size & morphology11

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 127 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 127 records