Elatine gratioloides

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Elatinaceae/Elatine

At a glance

Occurrence records2 744

Data sources9

Biological traits41

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Elatine gratioloides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 744 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF2 744 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Elatine gratioloides is a species of flowering plant belonging to the family Elatinaceae. Its native range is Australia to the south-west Pacific, including New Zealand. It was first described in 1839 by Allan Cunningham, who described it from a specimen from "a bog at Tauraki, Hokianga river".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length1.6 mm

Fruit width1.75 mm

Leaf length5 mm

Leaf size58.9 mm²

Leaf width3 mm

Leaf width max15 mm

Plant height0.3 m

⚠ sources differ — AusTraits: 0.3 m · TRY: 0.005 m

Seed length0.5 mm

⚠ sources differ — AusTraits: 0.5 mm · GIFT: 0.6 mm

Seed length max0.6 mm

Seed length min0.6 mm

Seed mass0.05 mg

Seed mass max0.05 mg

Seed mass min0.05 mg

Seed width0.175 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal+self+water

⚠ sources differ — AusTraits: barochory hydrochory zoochory · GIFT: unspecialized

Flowering timeyyynnnnnnnyy

Life formhydroannual

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproduction asexualpresent

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticaquatic

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTwetland vegetation, Savanna, dense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Elatine gratioloides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSLC217247.1 ↗610 bpAustralia

ACGT

GTCGAAACCTGCCTAGCAGAACGACCCGTGAACTGTAGTTTCATATTATGCGGAGTGCAGGAGGCGTATGCCCCTTGCACCACGCAGGTT …

Elatine gratioloides genes for ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, specimen_voucher: MEL2361305

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Elatine gratioloides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 744 records

Wild obs. + sensor1 861

Museum / vouchered845

Other38

Origin

Native183

Range

Area of Occupancy AOO5 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 042≤1 km 273≤10 km 165>10 km 9

1 489 georeferenced · 372 without coordinates

Open the mapobservation + sensor1 861

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 123≤1 km 112≤10 km 405>10 km 50

690 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence845

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	224
Mount Annan, AU	115
Brisbane, AU	96
Adelaide, AU	91
Canberra, AU	65
Auckland, NZ	38
Wellington, NZ	33
Kensington, AU	33
Hobart, AU	32
Christchurch, NZ	30
Palmerston, AU	28
Armidale, AU	17
Rotorua, NZ	6
Parkville, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Smithfield, AU	4
John T. Waterhouse Herbariumlocation not on record	4
QVMAGlocation not on record	3
James Cook Townsvillelocation not on record	2
Batemans Bay, AU	2
BGPAlocation not on record	2
Kew, GB	1
Chicago, US	1
IPA/SPlocation not on record	1
South Kensington, GB	1
University of Stellenboschlocation not on record	1
Claremont, US	1

27 institutions · 839 of 845 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Elatine gratioloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Elatine gratioloides

At a glance

Sources9 archives

Size & morphology14

Life cycle & reproduction12

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 744 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 744 records