Eilema caniola

(Hübner, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Eilema

At a glance

Occurrence records45 687

Data sources9

Biological traits2

DNA specimens102

eDNA detections97

Sources9 archives

Databases and archives Eilema caniola's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 687 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics102 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF45 687 records

Environmental DNA1 datasets · 10 countries97 detections

DNA & barcodingBOLD102 specimens

Genome at a glanceGoaT · NCBI≈782 Mbp

01Narrative

Eilema caniola, the hoary footman, is a moth of the family Erebidae. The species was first described by Jacob Hübner in 1808.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding102 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eilema caniola has left across the world's sequence archives.

At a glance

DNA specimens102

BINs1

Marker genes3

eDNA detections97

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus92 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

22Amostly conserved

82Tmostly conserved

88Amostly conserved

118Tmostly conserved

178Cvariable

187Tmostly conserved

226Cmostly conserved

250Cmostly conserved

268Tmostly conserved

514Cvariable

529Amostly conserved

547Tmostly conserved

562Amostly conserved

578Cmostly conserved

622Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATGGTAGGAACTTCTCTTAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.72%

Haplotypes22

BIN1

Most divergent pair2.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Manulea complanasame family5.0%Manulea ibericasame family5.2%Manulea bicolorsame family5.5%Indalia lutarellasame family5.6%Muscula musculasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PArgKDDX23

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Eilema caniola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈781 734 843 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eilema caniola0.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type45 687 records

Wild obs. + sensor41 695

Museum / vouchered2 205

Other1 787

Origin

Native4 108

Range

Area of Occupancy AOO26 884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 5 522≤1 km 3 147≤10 km 25 560>10 km 253

34 482 georeferenced · 7 213 without coordinates

Open the mapobservation + sensor41 695

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 44≤1 km 95≤10 km 1 381>10 km 65

1 585 georeferenced · 620 without coordinates

Open the institutions mapphysical evidence2 205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	361
Zürich, CH	243
UMUlocation not on record	176
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	115
Bern, CH	66
Frauenfeld, CH	47
Dhaka, BD	32
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	31
Musee d'Histoire Naturallelocation not on record	26
SFRAlocation not on record	21
Provincia di Livornolocation not on record	21
DanishLepidopterologicalSocietylocation not on record	15
Durban Natural Science Museumlocation not on record	15
Geneva, CH	15
Philadelphia, US	12
Paro, BT	11
Natural History Museum Rotterdamlocation not on record	9
Museum zu Allerheiligen Schaffhausenlocation not on record	8
Archäologie und Museum Baselland - Museum.BLlocation not on record	8
DABUHlocation not on record	7
MZLUlocation not on record	7
ZSMlocation not on record	7
Banyoles, ES	7
Tartu, EE	5
Tallinn, EE	5
CBDClocation not on record	4
EGBlocation not on record	4
Natural History Museum, Londonlocation not on record	2
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
NMOKlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
Salzburg, AT	1
Provo, US	1
UGRlocation not on record	1

34 institutions · 1 287 of 2 205 vouchered records shown · 918 without an institution code

09Environmental DNA97 detections

Where the DNA of Eilema caniola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map10 countries0

forest edgeFourres a Juniperus communis (F3.16)woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 13.9–21.8

Seasonal swing summer↔winter15.7 °C

Max temp (day)22.0 °C 17.3–25.5

Min temp (night)14.1 °C 9.20–18.6

Precipitation52.1 mm/mo 24.4–125

Air humidity59.5 % 52.4–62.5

Moisture balance-57.9 mm/mo -133–31.1

Vapour deficit890 Pa 628–1,130

Wind speed2.90 m/s 2.00–4.30

Cloud cover37.2 % 29.2–44.7

CHELSA 1981–2010, ~9 km grid, at location & month of 93 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eilema caniola

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type45 687 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type45 687 records