Eidophasia messingiella

Fischer von Röslerstamm, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Plutellidae/Eidophasia

At a glance

Occurrence records2 280

Data sources7

Biological traits2

DNA specimens41

eDNA detections40

Sources7 archives

Databases and archives Eidophasia messingiella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 280 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 280 records

Environmental DNA1 datasets · 9 countries40 detections

DNA & barcodingBOLD41 specimens

01Narrative

Eidophasia messingiella is a moth of the family Plutellidae. It is found in most of Europe (except Ireland, the Iberian Peninsula, Slovenia and Ukraine).Fauna Europaea The wingspan is 14–16 mm. Adults are on wing from June to July in one generation per year.UKmoths The larvae feed on Cardaria draba, Cardamine amara and Lunaria rediviva. Young larvae bore through a shoot of their host plants and make holes in the leaves. Older larvae feed on the underside of leaves. Pupation takes place in open network cocoons on the food plants or in detritus on the ground.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eidophasia messingiella has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes2

eDNA detections40

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

31Amostly conserved

91Amostly conserved

157Tmostly conserved

349Gmostly conserved

379Tmostly conserved

382Tvariable

400Amostly conserved

424Amostly conserved

475Cmostly conserved

490Tmostly conserved

547Tmostly conserved

619Tmostly conserved

628Gvariable

AACATTATATTTTTTATTTGGAATTTGATCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes7

BIN1

Most divergent pair3.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plutella vanellasame family6.1%Eidophasia vanellasame genus6.1%Plutella albidorsellasame family6.4%Plutella haasisame family7.6%Plutella armoraciaesame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 280 records

Wild obs. + sensor1 964

Museum / vouchered298

Other18

Origin

Native14

Range

Area of Occupancy AOO4 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 794≤1 km 499≤10 km 458>10 km 11

1 762 georeferenced · 202 without coordinates

Open the mapobservation + sensor1 964

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 117≤1 km 93≤10 km 20

230 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence298

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	68
NHMOlocation not on record	38
Provincia di Livornolocation not on record	26
SLU Artdatabankenlocation not on record	24
Tartu, EE	23
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	16
DABUHlocation not on record	12
Uniwersytet Łódzkilocation not on record	8
Rovaniemi, FI	7
Tallinn, EE	6
Philadelphia, US	6
Kuopio, FI	5
Stockholm, SE	4
Salzburg, AT	4
South Kensington, GB	2
Natural History Museum Rotterdamlocation not on record	2
Tilburg, NL	2
ZSMlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Nijmegen, NL	1
Trondheim, NO	1
NTNU-VMlocation not on record	1
Durban Natural Science Museumlocation not on record	1
neflocation not on record	1
Research Collection of Jari-Pekka Kaitilalocation not on record	1

28 institutions · 266 of 298 vouchered records shown · 32 without an institution code

09Environmental DNA40 detections

Where the DNA of Eidophasia messingiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.4–18.6

Seasonal swing summer↔winter19.7 °C

Max temp (day)19.1 °C 16.9–22.9

Min temp (night)11.6 °C 8.00–15.8

Precipitation88.8 mm/mo 52.1–165

Air humidity60.7 % 56.8–65.5

Moisture balance-39.1 mm/mo -73.4–106

Vapour deficit729 Pa 569–879

Wind speed3.10 m/s 1.50–4.50

Cloud cover39.0 % 34.3–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eidophasia messingiella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 280 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 280 records