Ectoedemia ilicis

(Mendes, 1910) van Nieukerken, 1985 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nepticulidae/Ectoedemia

At a glance

Occurrence records12

Data sources8

Biological traits0

DNA specimens9

eDNA detections5

Sources8 archives

Databases and archives Ectoedemia ilicis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 4 countries5 detections

DNA & barcodingBOLD9 specimens

01Narrative

Ectoedemia ilicis is a moth of the family Nepticulidae. It is found in the western Mediterranean Region, in southern France and the Iberian Peninsula. The wingspan is 5.1-7.2 mm. Adults are on wing from March to the end of June. There is one generation per year. The larvae feed on Quercus coccifera, Quercus ilex, Quercus ilex rotundifolia and Quercus suber. They mine the leaves of their host plant. The mine consists of a rather long, initially quite narrow, strongly contorted, gallery. The frass is concentrated in a broad central line. Male genitalia Female genitalia Female terminal abdominal segment

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ectoedemia ilicis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P665 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

15Tmostly conserved

21Tmostly conserved

25Amostly conserved

45Gmostly conserved

90Gmostly conserved

235Tmostly conserved

238Tmostly conserved

241Tmostly conserved

281Tmostly conserved

286Cmostly conserved

290Cmostly conserved

293Gmostly conserved

316Tmostly conserved

355Tmostly conserved

367Cmostly conserved

388Tmostly conserved

469Gmostly conserved

478Tmostly conserved

514Gmostly conserved

628Gmostly conserved

637Tmostly conserved

TGGAACTTTATATTTTATATTTGGAATTTGATCAGGTATAATTGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes3

BINs2

Most divergent pair0.60%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ectoedemia heringellasame genus3.2%Ectoedemia pseudoilicissame genus3.5%Ectoedemia haraldisame genus4.0%Ectoedemia liechtensteinisame genus4.6%Ectoedemia gilvipennellasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PEF1-alpha

animal barcodemarker

08Occurrence & distribution

Record type12 records

Wild obs. + sensor8

Museum / vouchered4

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 6

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA5 detections

Where the DNA of Ectoedemia ilicis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map4 countries0

limestone open grassy slopes, mixed forest p…maquis on limestoneQuercus ilex slope

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 9.00–17.6

Seasonal swing summer↔winter15.8 °C

Max temp (day)21.5 °C 13.4–23.0

Min temp (night)10.1 °C 5.00–11.7

Precipitation66.0 mm/mo 53.5–92.7

Air humidity59.7 % 54.0–61.2

Moisture balance-82.3 mm/mo -101–40.9

Vapour deficit805 Pa 443–926

Wind speed3.50 m/s 1.80–3.90

Cloud cover38.9 % 28.8–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)