Ectobius vittiventris

(Costa, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Blattodea/Ectobiidae/Ectobius

At a glance

Occurrence records8 239

Data sources7

Biological traits0

DNA specimens53

eDNA detections45

Sources7 archives

Databases and archives Ectobius vittiventris's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 239 records

Environmental DNA1 datasets · 7 countries45 detections

DNA & barcodingBOLD53 specimens

01Narrative

Ectobius vittiventris, the amber wood cockroach, belongs to the order Blattodea. It is a species of wood cockroach originally from southern Europe . It is completely harmless to humans and does not appear as a storage pest, as it only feeds on decomposing plant material and perishes within a few days in human dwellings due to a lack of food. Its original range is south of the Alps, but this species seems to have established itself permanently north of the Alps and in southern Germany. Since the amber forest cockroach is capable of flight, it accidentally finds its way into human dwellings, especially in areas close to its natural habitat. It is attracted by artificial light sources.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ectobius vittiventris has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

eDNA detections45

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

148Avariable

166Avariable

187Tvariable

211Amostly conserved

217Gvariable

235Cvariable

266Cvariable

274Avariable

340Cvariable

355Amostly conserved

485Tmostly conserved

502Avariable

557Tmostly conserved

628Amostly conserved

631Tvariable

634Cvariable

CACATTATACTTCATTTTTGGTGCTTGATCAGGTATAGTAGGAACTTCTCTAAGTATACTAATTCGGACTGAATTAAATCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair2.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllodromica marginatasame family9.7%Ectobius lapponicussame genus10.3%Ectobius pallidussame genus10.6%Ectobius corsorumsame genus11.5%Ectobius intermediussame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 239 records

Wild obs. + sensor7 872

Museum / vouchered367

Origin

Introduced519

Range

Area of Occupancy AOO14 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 4 309≤1 km 1 303≤10 km 241>10 km 242

6 095 georeferenced · 1 777 without coordinates

Open the mapobservation + sensor7 872

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 22≤1 km 70≤10 km 256>10 km 3

351 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	236
Paro, BT	38
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	17
Zürich, CH	15
Geneva, CH	12
South Kensington, GB	9
Natural History Museum, Londonlocation not on record	8
MfNBlocation not on record	7
Radicondoli, IT	6
Bavarian State Collection of Zoologylocation not on record	3
Bonn, DE	1

11 institutions · 352 of 367 vouchered records shown · 15 without an institution code

09Environmental DNA45 detections

Where the DNA of Ectobius vittiventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map7 countries0

Ronciers en bord de ripisylves14. Artificial - Terrestrial | 14.5 Urban Ar…Maquis sur dalles rocheusesRipisylves a lauriers-rosesChamps bord ruisseauUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 10.7–18.2

Seasonal swing summer↔winter14.9 °C

Max temp (day)19.1 °C 13.8–22.2

Min temp (night)13.1 °C 7.10–16.1

Precipitation89.2 mm/mo 52.4–121

Air humidity61.0 % 59.8–63.0

Moisture balance6.40 mm/mo -14.4–26.1

Vapour deficit738 Pa 496–806

Wind speed2.50 m/s 2.10–4.70

Cloud cover43.5 % 35.6–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ectobius vittiventris

At a glance

Sources7 archives

At a glance

Record type8 239 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 239 records