Echium amoenum

Fisch. & C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Echium

At a glance

Occurrence records30

Data sources8

Biological traits11

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Echium amoenum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Echium amoenum plant Echium amoenum (In Persian: گل گاوزبان) is one of the important medicinal herbs in Iranian traditional medicine. It is a biennial or perennial herb indigenous to the narrow zone of northern part of Iran, Caucasus and Russia, where it grows at an altitude ranging from . E. amoenum has been advocated for a variety of effects such as demulcent, anti-inflammatory and analgesic, especially for the common cold, and as an anxiolytic and sedative.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.8 m

Plant height min0.5 m

Life cycle & reproduction5

Flowering endJul

Flowering startMay

Life formbiennial or perennial

Life spanbiennial

Raunkiær life formtherophyte

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTgarden,rivers,stonyplaces

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echium amoenum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSLC426084.1 ↗613 bp

ACGT

TCGAATCCTGCACAGCAGAACCACTCGCGAACATGTTAACAAACCCGATGGGGCGTCGAATGTAGGGATCCCTTGCACTCGATCGTCCCT …

Echium amoenum Tarbiat Modares University Herbarium 2013-03-12 gene for ITS1, 5.8S rRNA and ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Echium amoenum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ghaffari, S. M. 1996. Chromosome studies in some species of Boraginaceae from Iran. Iran. J. Bot. 7(1): 81–93.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type30 records

Wild obs. + sensor12

Museum / vouchered16

Cultivated / captive2

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 2≤1 km 8>10 km 1

11 georeferenced · 1 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 3

5 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence16

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	5
Moscow State Universitylocation not on record	4
Wuzhou, CN	2
Wlocation not on record	2
Vancouver, CA	1
Northridge, US	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1

7 institutions · 16 of 16 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)