Echinus esculentus

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Echinoidea/Camarodonta/Echinidae/Echinus

At a glance

Occurrence records54 591

Data sources13

Biological traits7

DNA specimens11

eDNA detections7

Sources13 archives

Databases and archives Echinus esculentus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 838 records↗

OBISOcean Biodiversity Information System28 753 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF · OBIS54 591 records

Environmental DNA2 datasets · 2 countries7 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Echinus esculentus, the European edible sea urchin or common sea urchin, is a species of marine invertebrate in the Echinidae family. It is found in coastal areas of western Europe down to a depth of 1200 m.Marine Species Identification Portal It is considered "Near threatened" in the IUCN Red List of Threatened Species. Test of Echinus esculentus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length17.6 cm

Life cycle & reproduction1

Max. longevity96 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max100 m

Depth min0 m

03Chemical composition4 compounds

Compounds documented for Echinus esculentus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Naphthoquinones4

Documented compounds4 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Echinochrome A		present	LOTUS
Spinochrome B		present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinus esculentus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes4

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Avariable

4Avariable

5Cvariable

8Tvariable

9Avariable

12Tvariable

13Gvariable

14Avariable

31Gmostly conserved

92Cmostly conserved

202Cvariable

289Cmostly conserved

370Cmostly conserved

376Avariable

499Cmostly conserved

616Cvariable

646Tvariable

AACACTTTATTTGATTTTTGGAGCTTGAGCGGGAATGGTAGGAACTGCCATGAGTGTAATTATACGCGCTGAACTAGCACAACCGGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gracilechinus alexandrisame family5.8%Gracilechinus multidentatussame family6.4%Gracilechinus eleganssame family6.8%Loxechinus albussame order12.2%Sterechinus neumayerisame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Echinus esculentus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 032 866 170 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Echinus esculentus1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–382n range25median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 321×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 381×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

08Occurrence & distribution

Record type54 591 records

Wild obs. + sensor30 769

Museum / vouchered20 423

Other3 399

Range

Area of Occupancy AOO29 564 km²

Depth

0–200 m sunlit17 831

200–1000 m twilight30

1–4 km midnight0

>4 km abyssal0

median 17.7 m · max 477 m · 17 861 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 23 007≤1 km 355≤10 km 45>10 km 691

24 098 georeferenced · 6 671 without coordinates

Open the mapobservation + sensor30 769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 1 094≤1 km 137≤10 km 113>10 km 43

1 387 georeferenced · 19 036 without coordinates

Open the institutions mapphysical evidence20 423

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	320
Gothenburg, SE	94
SLU Artdatabankenlocation not on record	87
Bergen, NO	64
NTNU-VMlocation not on record	59
PNHSlocation not on record	50
Cambridge, US	34
South Kensington, GB	25
Frankfurt am Main	23
University of Oslo (UiO)location not on record	15
CEFASlocation not on record	12
Helsinki, FI	9
CASlocation not on record	7
730location not on record	7
Institut Francais pour l'Etude de la Merlocation not on record	7
486location not on record	6
Stockholm, SE	6
ARMS-MBONlocation not on record	4
MZLUlocation not on record	4
Natural History Museum Rotterdamlocation not on record	3
Natural History Museum, Londonlocation not on record	2
Chicago, US	2
Brussels, BE	2
RBINS-Scientific Heritagelocation not on record	2
Paris, FR	2
Barcelona, ES	1
National Museum of Natural Sciencelocation not on record	1
Norwegian Institute of Marine Researchlocation not on record	1
Washington, US	1
Uppsala University, Department of Systematic Biologylocation not on record	1
Citadel Hill, GB	1

31 institutions · 852 of 20 423 vouchered records shown · 48 without an institution code

09Environmental DNA7 detections

Where the DNA of Echinus esculentus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries2

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Marine Protected Area; protected; 9.5 - Subt…Rock bottomMarine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 7.20–11.7

Seasonal swing summer↔winter18.2 °C

Max temp (day)13.4 °C 9.00–13.4

Min temp (night)7.60 °C 5.10–7.60

Precipitation93.5 mm/mo 65.6–95.1

Air humidity60.7 % 60.5–62.7

Moisture balance-13.0 mm/mo -20.4–13.2

Vapour deficit542 Pa 388–542

Wind speed3.80 m/s 3.80–6.70

Cloud cover63.3 % 48.2–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Echinus esculentus

At a glance

Sources13 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment2

Uses & economy1

Other traits2

Compound class profile1 class

Documented compounds4 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type54 591 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type54 591 records