Echinops adenocaulos

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Echinops

At a glance

Occurrence records3 244

Data sources5

Biological traits8

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Echinops adenocaulos's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 244 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF3 244 records

DNA & barcodingNCBIsequences

01Narrative

Echinops adenocaulos is a species of flowering plant in the family Asteraceae. It is native to Israel, Palestine, Jordan, Syria, and Lebanon.Flora of Israel Online, Echinops adenocaulos Boiss., קיפודן מצוי includes photos and distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Size & morphology3

Seed mass32.25 mg

Seed mass max35.87 mg

Seed mass min26.51 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment3

Aquaticterrestrial

Growth form detailedherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinops adenocaulos has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW621242.1 ↗632 bpTurkey

ACGT

TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAATGACAATCGGCATCAGGGTGATTAGGTATGAGCCTGGGAGCCATGATGCTTT …

Echinops adenocaulos isolate CV4417 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type3 244 records

Wild obs. + sensor3 243

Museum / vouchered1

Range

Area of Occupancy AOO5 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 266≤1 km 62≤10 km 239>10 km 5

572 georeferenced · 2 671 without coordinates

Open the mapobservation + sensor3 243

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	1

1 institutions · 1 of 1 vouchered records shown

At a glance

Sources5 archives

Size & morphology3

Life cycle & reproduction1

Diet & foraging1

Habitat & environment3

At a glance

Record type3 244 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 1 geolocated

Record type3 244 records