Echinolittorina punctata

(Gmelin, 1791) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Littorinidae/Echinolittorina

At a glance

Occurrence records726

Data sources9

Biological traits2

DNA specimens29

eDNA detections32

Sources9 archives

Databases and archives Echinolittorina punctata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility669 records↗

OBISOcean Biodiversity Information System57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS726 records

Environmental DNA1 datasets · 9 countries32 detections

DNA & barcodingBOLD29 specimens

01Narrative

Echinolittorina punctata is a species of sea snail, a marine gastropod mollusk in the family Littorinidae, the winkles or periwinkles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinolittorina punctata has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes2

eDNA detections32

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

5Tmostly conserved

40Amostly conserved

70Tmostly conserved

166Amostly conserved

172Gmostly conserved

181Cvariable

211Amostly conserved

340Cmostly conserved

526Amostly conserved

562Gmostly conserved

583Gmostly conserved

628Tmostly conserved

AACATTATATATTTTATTTGGTATATGATCTGGTTTAGTAGGTACTGCTCTAAGGCTTCTTATCCGAGCTGAGTTAGGGCAACCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes27

BINs2

Most divergent pair4.7%

EuropeAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinolittorina pulchellasame genus4.7%Echinolittorina ziczacsame genus12.9%Echinolittorina malaccanasame genus13.2%Echinolittorina paytensissame genus13.7%Echinolittorina interruptasame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type726 records

Wild obs. + sensor554

Museum / vouchered171

Other1

Origin

Native65

Range

Area of Occupancy AOO1 620 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.2 m · max 9 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 206≤1 km 147≤10 km 17>10 km 6

376 georeferenced · 178 without coordinates

Open the mapobservation + sensor554

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 12≤1 km 20≤10 km 26>10 km 22

80 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	47
Paris, FR	34
Philadelphia, US	15
Museu Nacional de História Natural e da Ciêncialocation not on record	11
Santa Barbara Museum of Natural Historylocation not on record	10
Brussels, BE	7
RBINS-Scientific Heritagelocation not on record	6
Frankfurt am Main	2
Denver, US	1
John May Museum of Natural Historylocation not on record	1
Cantablocation not on record	1
Champaign, US	1
Ann Arbor, US	1

13 institutions · 137 of 171 vouchered records shown

09Environmental DNA32 detections

Where the DNA of Echinolittorina punctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 12.9–28.8

Seasonal swing summer↔winter19.5 °C

Max temp (day)20.1 °C 17.1–34.9

Min temp (night)9.30 °C 8.10–22.2

Precipitation52.6 mm/mo 18.9–72.2

Air humidity53.6 % 45.4–58.3

Moisture balance-56.6 mm/mo -145–-20.6

Vapour deficit879 Pa 733–2,110

Wind speed2.80 m/s 2.30–4.30

Cloud cover38.3 % 16.6–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)