Echinococcus multilocularis

(Leuckart, 1863) · species

image placeholder — illustration coming later

Animalia/Platyhelminthes/Cestoda/Cyclophyllidea/Taeniidae/Echinococcus

At a glance

Occurrence records909

Data sources10

Biological traits0

DNA specimens601

eDNA detections431

Sources10 archives

Databases and archives Echinococcus multilocularis's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility909 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI431 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics601 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF909 records

Environmental DNA1 datasets · 7 countries431 detections

DNA & barcodingBOLD601 specimens

Genome at a glanceGoaT · NCBI372 Mbp

01Narrative

Echinococcus multilocularis is a small cyclophyllid tapeworm found extensively in the northern hemisphere. E. multilocularis, along with other members of the Echinococcus genus (especially E. granulosus), produce diseases known as echinococcosis. Unlike E. granulosus, E. multilocularis produces many small cysts (also referred to as locules) that spread throughout the internal organs of the infected animal. The resultant disease is called Alveolar echinococcosis, and is caused by ingesting the eggs of E. multilocularis. The parasite is commonly maintained in a wildlife life cycle involving two mammalian hosts. Wild canids, dogs, and less commonly cats act as definitive hosts, harbouring the adult stage of the tape worm. Voles are the intermediate hosts. Ingestion of a rodent containing alveolar hydatid cysts by a wild canid can result in a heavy infestation of tapeworms.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding601 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Echinococcus multilocularis has left across the world's sequence archives.

At a glance

DNA specimens601

BINs1

Marker genes13

eDNA detections431

Countries26

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus352 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

187Tvariable

239Tvariable

625Tvariable

638Cvariable

TATTGGAGTGATTTATAGATTATTAGGTATATGGTCTGGTTTTGTTGGTTTAAGTTTTAGTTTGTTGATTCGTGTTAATTTTTTGGAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes30

BIN1

Most divergent pair17.8%

AsiaEuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Echinococcus equinussame genus8.1%Echinococcus canadensissame genus8.2%Echinococcus ortleppisame genus8.9%Echinococcus granulosussame genus10.4%Taenia soliumsame family15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_000928 ↗ · 12 protein · 22 tRNA · 2 rRNA

ND5COX3CYTBND4LND4ATP6ND2ND1ND3COX1COX2ND6l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Echinococcus multilocularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size371 640 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Echinococcus multilocularis0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness61% BUSCO

07Deep time~1.38 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.38 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type909 records

Wild obs. + sensor2

Museum / vouchered907

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 1≤1 km 45≤10 km 539>10 km 62

647 georeferenced · 260 without coordinates

Open the institutions mapphysical evidence907

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
München, DE	626
Washington, US	39
USNPClocation not on record	26
Lubbock, US	9
Geneva, CH	7
Gothenburg, SE	1
Harold Winfred Manter Laboratory of Parasitologylocation not on record	1

7 institutions · 709 of 907 vouchered records shown · 40 without an institution code

09Environmental DNA431 detections

Where the DNA of Echinococcus multilocularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found431

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 431 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C -2.20–10.3

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.1 °C 1.70–15.8

Min temp (night)3.60 °C -7.00–4.30

Precipitation36.6 mm/mo 10.4–122

Air humidity57.4 % 48.1–62.8

Moisture balance-33.9 mm/mo -73.1–-0.6

Vapour deficit636 Pa 364–638

Wind speed4.20 m/s 2.10–4.60

Cloud cover42.2 % 18.1–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)