Dytiscus fasciventris

Say, 1824 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dytiscidae/Dytiscus

At a glance

Occurrence records526

Data sources7

Biological traits0

DNA specimens10

eDNA detections9

Sources7 archives

Databases and archives Dytiscus fasciventris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility526 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF526 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Dytiscus fasciventris, the understriped diving beetle, is a species of predaceous diving beetle in the family Dytiscidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dytiscus fasciventris has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

49Amostly conserved

76Avariable

184Avariable

223Avariable

268Tmostly conserved

271Tvariable

316Avariable

355Gmostly conserved

370Gvariable

373Gvariable

376Cmostly conserved

416Gmostly conserved

469Amostly conserved

559Amostly conserved

562Gvariable

622Gvariable

631Gvariable

652Cvariable

AACTTTATATTTTATTTTCGGGGCCTGAGCAGGAATAGTAGGAACATCATTAAGAATACTTATTCGAGCAGAATTAGGAAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dytiscus hatchisame genus5.9%Dytiscus semisulcatussame genus9.1%Dytiscus marginalissame genus9.6%Dytiscus dimidiatussame genus9.8%Dytiscus dauricussame genus10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type526 records

Wild obs. + sensor317

Museum / vouchered209

Range

Area of Occupancy AOO1 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 233≤1 km 19≤10 km 9>10 km 24

285 georeferenced · 32 without coordinates

Open the mapobservation + sensor317

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 26≤1 km 22≤10 km 28>10 km 16

92 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	34
Toronto, CA	31
University of Alberta Museums (UAM)location not on record	26
Champaign, US	24
Royal Saskatchewan Museumlocation not on record	23
Edmonton, CA	22
US	6
University of Guelphlocation not on record	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Saint John, CA	5
New Haven, US	4
Lexington, US	4
Wuzhou, CN	3
Espace pour la vielocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University Park, US	3
WIlocation not on record	1
CUlocation not on record	1
SOVTlocation not on record	1

19 institutions · 204 of 209 vouchered records shown · 5 without an institution code

09Environmental DNA9 detections

Where the DNA of Dytiscus fasciventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Forestnear buildingex. trapped beaver (Castor canadensis)Temperate mixed forestWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C -3.20–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)15.0 °C 2.70–24.2

Min temp (night)8.00 °C -8.40–19.9

Precipitation90.9 mm/mo 12.6–101

Air humidity58.0 % 55.9–62.4

Moisture balance-32.1 mm/mo -97.2–14.1

Vapour deficit552 Pa 225–1,086

Wind speed4.10 m/s 1.80–6.10

Cloud cover51.7 % 39.2–65.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)