Durio zibethinus

Murray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Durio

At a glance

Occurrence records917

Data sources14

Biological traits34

DNA specimens28

eDNA detections25

Sources14 archives

Databases and archives Durio zibethinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility917 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionFooDB · LOTUS · NPASS5 633 compounds

Occurrence & distributionGBIF917 records

Environmental DNA1 datasets · 2 countries25 detections

DNA & barcodingBOLD · NCBI28 specimens

Genome at a glanceCCDB · GoaT · NCBI≈818 Mbp

01Narrative

Le durian ou durion, Durio zibethinus (Murray) est une espèce d'arbre tropical à feuillage persistant de la famille des Bombacaceae ou des Malvaceae qui produit des fruits comestibles. Ce fruit, lui aussi appelé durian, est récolté en Asie du Sud-Est mais également dans les îles du Pacifique et en Amérique du Sud. On en trouve, par exemple, sur les marchés de Guyane fin mars, début avril. Il se présente comme une grosse baie ovoïde, pesant jusqu'à 5 kg, avec une carapace de grosses épines et poussant en haut de grands arbres. Il est connu pour son goût particulier et sa forte odeur. Le genre Durio compte trente espèces, toutes originaires du Sud-Est asiatique. Au moins neuf d'entre elles produisent des fruits comestibles. L'espèce Durio zibethinus est la seule disponible sur le marché international, la vente des autres espèces restant confinée aux régions où elles sont produites.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length225 mm

Fruit length max300 mm

Fruit length min150 mm

Leaf length71.25 mm

Leaf length max20 mm

Leaf length min15 mm

Leaf width45 mm

Plant height27.5 m

⚠ sources differ — GIFT: 27.5 m · TRY: 12.55 m

Seed length39.2 mm

Seed mass18 094 mg

Seed mass max20 000 mg

Seed mass min14 783 mg

Seed width max22.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formtree

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.94 mm²/mg

Wood density563 mg/cm³

Other traits2

Leaf thickness0.014 mm

Seed height max21.2 mm

03Chemical composition5 633 compounds

Compounds documented for Durio zibethinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingFruits

Compound class profile5 classes

Aminoacids67

Glycerophospholipids57

Cinnamic acids and derivatives30

Purine nucleos(t)ides26

Monosaccharides25

Documented compounds5 633 total

Tissue Source Quantified only

Compound	Amount	Source
Sugars	27,500 mg/100g	FooDB
Potassium	1,205.5 mg/100g	FooDB
Phosphorus	119.5 mg/100g	FooDB
L-Ascorbic acid	75.5 mg/100g	FooDB
Retinol	44 IU	FooDB
Calcium	33.8 mg/100g	FooDB

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Durio zibethinus has left across the world's sequence archives.

At a glance

DNA specimens28

Marker genes3

GenBank sequences10

eDNA detections25

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPQ808937.1 ↗252 bp

ACGT

ATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTTCTTATACT …

Durio zibethinus isolate BT_LQ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL9★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Durio zibethinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈817 618 165 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Durio zibethinus0.82 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidypolyploid inferred

Chromosome records28–562n range56median56mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 563×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · Cave1959

CCDB · book-indian_vol1 — Mangenot, S. & Mangenot G. 1958, 1962

CCDB · book-fedorov — Mangenot S., Mange- ' not G. 1958, 1962

CCDB · Cave1959 — Mang. & Mang. 1958 eference

2n 281×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Datta, P.C. & Biswas, C. 1969

n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DATTA, P.C., & c. BISWAS. 1969. Karyotype study of Durio zibenthinus L. Genetica 40: 40-42. ~~~

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.2% BUSCO

08Occurrence & distribution

Record type917 records

Wild obs. + sensor316

Museum / vouchered112

Cultivated / captive487

Other2

Origin

Introduced1

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 121≤1 km 59≤10 km 27>10 km 24

231 georeferenced · 85 without coordinates

Open the mapobservation + sensor316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9>10 km 2

11 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence112

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 55>10 km 97

152 georeferenced · 335 without coordinates

Open the mapnot free-living487

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	9
Saint Louis, US	7
Xiamen, CN	6
EL PASO, US	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
UFBAlocation not on record	1
HNBlocation not on record	1
Philadelphia, US	1
Laboratorio de Ictiologialocation not on record	1
Auckland, NZ	1
arosemena tola, EC	1
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Taipei, TW	1
Burlington, US	1
ASUlocation not on record	1
Fort Worth, US	1

20 institutions · 45 of 112 vouchered records shown · 61 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA25 detections

Where the DNA of Durio zibethinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.7 °C 26.1–28.7

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.6 °C 29.5–31.7

Min temp (night)25.1 °C 22.6–25.1

Precipitation201 mm/mo 198–269

Air humidity62.8 % 62.8–68.1

Moisture balance45.1 mm/mo 43.1–133

Vapour deficit1,457 Pa 1,080–1,465

Wind speed2.40 m/s 1.20–2.40

Cloud cover72.8 % 57.6–72.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Durio zibethinus

At a glance

Sources14 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging1

Habitat & environment7

Physiology & chemistry4

Other traits2

Compound class profile5 classes

Documented compounds5 633 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type917 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds5 633 total