Drosera schizandra

Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Droseraceae/Drosera

At a glance

Occurrence records33

Data sources9

Biological traits18

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Drosera schizandra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF33 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB592 Mbp

01Narrative

Drosera schizandra is a species of Drosera found in Queensland, Australia. Commonly called the notched sundew or heart-leaf sundew, it has round, oval leaves that sometimes develop notched tips as they grow, giving them a heartlike shape. Range of D. schizandra in the wild

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology4

Fruit length1.5 mm

Leaf length90 mm

Leaf width45 mm

Plant height0.15 m

Life cycle & reproduction5

Flowering timennnnnnnnnyyn

Life formperennial

Life spanperennial

Raunkiær life formchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb

Leaf shapeobovate

Woodinessnon-woody

⚠ sources differ — AusTraits: herbaceous · GIFT: woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drosera schizandra has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKP171692.1 ↗748 bp

ACGT

GAACCTGCGGAAGGATCATTGTCGAAACCTCGATCGAAACGAATGACTTACAAACACGTTAACAAAATAGACGGAACGGTTCGCGTTGTG …

Drosera schizandra isolate DrosR18 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Drosera schizandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size591 789 795 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Drosera schizandra0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kondo, K. & M. C. Oliver. 1979. Chromosome numbers of four species of Drosera (Droseraceae). Ann. Missouri Bot. Gard. 66: 584–587.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type33 records

Wild obs. + sensor6

Museum / vouchered27

Origin

Native1

Introduced1

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤1 km 1>10 km 5

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 25

26 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	12
Smithfield, AU	9
Mount Annan, AU	2
Museo Entomologico de Leonlocation not on record	1
James Cook Townsvillelocation not on record	1
Adelaide, AU	1

6 institutions · 26 of 27 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)