Drosera intermedia
Hayne · speciesAt a glance
Occurrence records87 770
Data sources12
Biological traits38
DNA specimens30
eDNA detections14
Sources12 archives
Databases and archives Drosera intermedia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility87 770 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics30 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS · NPASS15 compounds
Occurrence & distributionGBIF87 770 records
Environmental DNA1 datasets · 4 countries14 detections
DNA & barcodingBOLD · NCBI30 specimens
Genome at a glanceCCDB · GoaT1.8 Gbp
01Narrative
La Droséra intermédiaire est une plante herbacée de la famille des Droséracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass0.84 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · LEDA: 22.04 mm² · GIFT: 22.04 mm²
Plant height0.035 m
⚠ sources differ — GIFT: 0.035 m · LEDA: 0.025 m · TRY: 0.03 m
Plant height generative0.09 m
Plant height max0.1 m
Plant height min0.02 m
Seed length0.74 mm
Seed mass0.029 mg
⚠ sources differ — TRY: 0.029 mg · LEDA: 0.03 mg · GIFT: 0.028 mg
Seed mass max0.04 mg
Seed mass min0.02 mg
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: evergreen
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Pollination syndromeother
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number111
Self fertilizationpresent
Diet & foraging2
Carnivorycarnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTRestinga
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)177 mg/g
Photosynthetic pathwayC3
Seed longevity index0.25
Specific leaf area (SLA)28.31 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition15 compounds
Compounds documented for Drosera intermedia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cholestane steroids5
Naphthalenes and derivatives3
Spirostane steroids3
Naphthoquinones3
Hydroxy fatty acids1
Documented compounds15 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(3S,8S,9S,10R,13S,14S,16S,17R)-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]oxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-3'-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[[(3S,8S,9S,10R,13S,14S,16S,17R)-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-6-[[(3S,8S,9S,10R,13S,14S,16S,17R)-16-hydroxy-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-2-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5R)-5-hydroxy-2-[[(1R,3R,8S,9S,10R,13S,14S,16S,17R)-3-hydroxy-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-1-yl]oxy]-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4S,5S,6R)-2-(4,8-dihydroxy-3-methylnaphthalen-1-yl)oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-(4,8-dihydroxy-6-methylnaphthalen-1-yl)oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| 1beta-hydroxyspirosta-5,25(27)-dien-3beta-yl O-alpha-L-rhamnopyranosyl-(1->4)-beta-D-glucopyranoside | present | NPASS | |
| 3-Chloro-5-hydroxy-2-methylnaphthalene-1,4-dione | present | LOTUS | |
| [(3R,4S,5R,6S)-4-acetyloxy-6-[[(1R,3R,8S,9S,10R,13S,14S,16S,17R)-3-hydroxy-17-[(2S,3S)-3-hydroxy-6-methylheptan-2-yl]-10,13-dimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-1-yl]oxy]-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] acetate | present | NPASS |
05DNA & barcoding30 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drosera intermedia has left across the world's sequence archives.
At a glance
DNA specimens30
Marker genes6
GenBank sequences10
eDNA detections14
Countries8
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCACGGCCGAGGGCACGTCTGTCTGGGCGTCGCATGC …
Drosera intermedia voucher PHK 016 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Drosera intermedia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 760 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Drosera intermedia1.76 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records20–202n range20median20mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2033×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — TOMEI P.E., GIORDANI A. - 1978. Il genere Drosera in Toscana.. Giorn. Bot. Ital. , 112(4): 324.
CCDB · ita-fl — FICINI G., GARBARI F., GIORDANI A., TOMEI P.E. - 1980. Numeri cromosomici per la flora italiana:683-689.. Inform. Bot. Ital. , 12(2): 113-116.
CCDB · brit-fl — Culham, A. (1993)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2159
CCDB · fl-europaea — B e h r e , 1929
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. IOPB chromosome number reports LXXVII. Taxon 31: 766–768.
CCDB · ipcn-api-dl — Kapoor, B. M., S. Ramcharitar & C. Gervais. 1987. Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amérique. Naturaliste Canad. 114: 105–116.
CCDB · ipcn-api-dl — Kondo, K. & M. Segawa. 1988. A cytotaxonomic study in artificial hybrids between Drosera anglica Huds. and its certain closely related species in series Drosera, section Drosera, subgenus Drosera, Drosera. Kromosomo 51–52: 1697–1709.
CCDB · ipcn-api-dl — Jankun, A. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Hoshi, Y. & K. Kondo. 1998. Chromosome differentiation in Drosera, subgenus Rorella, section Rossolis. Cytologia 63: 199–211.
CCDB · ipcn-api-dl — Ficini, G., F. Garbari, A. Giordani & P. E. Tomei. 1980. Numeri cromosomici per la Flora Italiana: 683-689. Inform. Bot. Ital. 12: 113–116.
CCDB · ipcn-api-dl — GERVAIS, C. & R. Gauthier. 1999. Étude cytotaxonomique des espèces et des hybrides naturels du genre Drosera (Droseraceae) au Québec. Acta Bot. Gall. 146(4): 387–401.
CCDB · book-ipcn67-71 — ROTHFELS, K., & M. HEIMBURGER. 1968. Chromosome size and DNA values in sundews (Droseraceae). Chromosoma (Berl.) 25: 96-103.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-fedorov — Rosenberg 1909c
CCDB · book-fedorov — Levine 1916
CCDB · book-fedorov — Behre 1929
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Wood 1955
CCDB · book-fedorov — Gadella, Kliphuis 1963, 1966
CCDB · book-atlas-flowering-plants — Behre 1929
CCDB · kew — Rothfels K, Heimburg M. 1968. Chromosome size and DNA values in sundews (Droseraceae). Chromosoma 25: 96-103.
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Ficini, G., Garbari, F. & Giordani, A. (1980). Numeri cromosomici per la flora italiana: 683-689. Inf. Bot. Ital. 12: 113-116.
CCDB · CromoCat 2015 — Gervais, C. & Gauthier, R. (1999). Étude cytotaxonomique des espèces et des hybrides naturels du genre Drosera (Droseraceae) au Québec Acta Bot. Gall. 146(4): 387–401
CCDB · CromoCat 2015 — Kapoor, B. M., Ramcharitar, S. & Gervais, C. (1987). Liste annotée de nombres chromosomiques de la flore vasculare du Nord-Est de l'Amérique. V. Naturaliste Canad. 114: 105-116.
CCDB · CromoCat 2015 — Kondo, K. & Segawa, M. (1988). A cytotaxonomic study in artificial hybrids between Drosera anglica Huds. and its certain closely related species in series Drosera, section Drosera, subgenus Drosera, Drosera. Kromosomo 51–52: 1697–1709
CCDB · CromoCat 2015 — Pogan, E., A. Jankun & Z. Sawicka (1990). Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1-17.
n 107×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2
CCDB · ipcn-api-dl — Kapoor, B. M., S. Ramcharitar & C. Gervais. 1987. Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amérique. Naturaliste Canad. 114: 105–116.
CCDB · ipcn-api-dl — FAASEN, P. V. & P. NADEAU. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.
CCDB · book-ipcn67-71 — KONDO, K. 1970. Chromosome numbers in Drosera and Dionaea in North Carolina. J. Jap. Bot. 45: 139-144.
CCDB · book-ipcn75-78 — Faasen & Nadeau 1976
CCDB · Cave1956supp — Wood 1955
CCDB · CromoCat 2015 — Faasen, P., van & Nadeau, P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LI]. Taxon 25(1): 156-158.
CCDB · CromoCat 2015 — Kapoor, B. M., Ramcharitar, S. & Gervais, C. (1987). Liste annotée de nombres chromosomiques de la flore vasculare du Nord-Est de l'Amérique. V. Naturaliste Canad. 114: 105-116.
n 201×CCDB · book-ipcn65
CCDB · book-ipcn65 — J. L. Rogers 1965
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type87 770 records
Wild obs. + sensor81 140
Museum / vouchered6 468
Cultivated / captive19
Other143
Origin
Native2 833
Introduced2
Range
Area of Occupancy AOO84 872 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 13 609≤1 km 10 208≤10 km 41 497>10 km 2 794
68 108 georeferenced · 13 032 without coordinates
Open the mapobservation + sensor81 140
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 332≤1 km 1 293≤10 km 1 850>10 km 738
4 213 georeferenced · 2 255 without coordinates
Open the institutions mapphysical evidence6 468
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy85% within 1 km
≤1 km 11>10 km 2
13 georeferenced · 6 without coordinates
Open the mapnot free-living19
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions112 of 212 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 425 |
| Olocation not on record | 361 |
| LDlocation not on record | 337 |
| Uniwersytet Wrocławskilocation not on record | 306 |
| Philadelphia, US | 274 |
| Uppsala, SE | 214 |
| MeiseBGlocation not on record | 214 |
| Brussel, BE | 198 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 150 |
| BFLlocation not on record | 142 |
| St. Paul, US | 137 |
| Madison, US | 135 |
| Turku, FI | 104 |
| KMNlocation not on record | 102 |
| Oskarshamn, SE | 100 |
| University of New Hampshirelocation not on record | 94 |
| Montréal, CA | 91 |
| Chicago, US | 90 |
| Bergen, NO | 87 |
| Bronx, US | 82 |
| SLU Artdatabankenlocation not on record | 82 |
| Ann Arbor, US | 82 |
| Acadia Universitylocation not on record | 77 |
| Québec, CA | 75 |
| Trondheim, NO | 74 |
| Tartu, EE | 68 |
| Görlitz, DE | 64 |
| Salzburg, AT | 62 |
| Chongqing Museumlocation not on record | 61 |
| Philadelphia, US | 61 |
| Université Lavallocation not on record | 58 |
| Kuopio, FI | 56 |
| New Haven, US | 52 |
| Burlington, US | 44 |
| Dresden, DE | 42 |
| New Brunswick, US | 42 |
| Provincia di Livornolocation not on record | 40 |
| Oulu, FI | 38 |
| University of Stellenboschlocation not on record | 38 |
| Saint John, CA | 34 |
| TUR-Alocation not on record | 33 |
| Zürich, CH | 32 |
| Bern, CH | 32 |
| Jena Microbial Resource Collectionlocation not on record | 31 |
| MAlocation not on record | 28 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 27 |
| Tampa, US | 27 |
| South Kensington, GB | 24 |
| College Park, US | 23 |
| Fort Worth, US | 22 |
| Jyväskylä, FI | 22 |
| Millersville, US | 20 |
| San Sebastián, ES | 19 |
| Vitoria, ES | 19 |
| Toronto, CA | 18 |
| Claremont, US | 17 |
| Bloomington, US | 17 |
| BRNUlocation not on record | 17 |
| BIO-UNIPIlocation not on record | 17 |
| GJOlocation not on record | 16 |
| Saint Louis, US | 15 |
| Adam Mickiewicz University in Poznańlocation not on record | 14 |
| Miami, US | 14 |
| Jackson, US | 14 |
| Green Bay, US | 14 |
| BSBIlocation not on record | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Tallinn, EE | 12 |
| USP-IBlocation not on record | 12 |
| Durham, US | 12 |
| Tilburg, NL | 12 |
| Tuscaloosa, US | 12 |
| BClocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| University of Hamburglocation not on record | 11 |
| Mlocation not on record | 10 |
| Moscow State Universitylocation not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Pullman, US | 10 |
| Philadelphia, US | 10 |
| Williamsburg, US | 10 |
| Salamanca, ES | 10 |
| Mississippi State, US | 9 |
| Whitewater, US | 9 |
| Keene State Universitylocation not on record | 9 |
| Barcelona, ES | 9 |
| Bangkok, TH | 8 |
| Uniwersytet Jagiellońskilocation not on record | 8 |
| Austin, US | 8 |
| Chapel Hill, US | 8 |
| Columbia, US | 8 |
| Cambridge, US | 8 |
| US | 7 |
| Federal University of Espírito Santolocation not on record | 7 |
| UFESlocation not on record | 7 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Bourges, FR | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Chicago, US | 6 |
| University of Southern Mississippilocation not on record | 6 |
| Dekalb, US | 6 |
| Valdosta State Universitylocation not on record | 6 |
| Allentown, US | 6 |
| Staten Island, US | 6 |
| Wlocation not on record | 5 |
| Vancouver, CA | 5 |
| Knoxville, US | 5 |
| Porvoo, FI | 5 |
| NMBU:MINAlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| TROMlocation not on record | 5 |
| Salvador, BR | 4 |
| Nijmegen, NL | 4 |
| València, ES | 4 |
| CJBGlocation not on record | 4 |
| Namur, BE | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| AUAlocation not on record | 4 |
| UGentlocation not on record | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Berlin, DE | 4 |
| CASlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Cheney, US | 3 |
| Denver, US | 3 |
| ER Hellerlocation not on record | 3 |
| Moscow, US | 3 |
| BDBClocation not on record | 3 |
| Podgorica, ME | 3 |
| BAYLUlocation not on record | 3 |
| Logan, US | 3 |
| Paris, FR | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| University of Wisconsinlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| San Angelo, US | 3 |
| Dover, US | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Longwood Universitylocation not on record | 3 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| JBRJlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Wellington, NZ | 2 |
| Bando, JP | 2 |
| Morgantown, US | 2 |
| ISAlocation not on record | 2 |
| Brookings, US | 2 |
| Xiamen, CN | 2 |
| ER-Gaucklocation not on record | 2 |
| Forssa, FI | 2 |
| DULlocation not on record | 2 |
| Göteborg, SE | 2 |
| McWane Science Centerlocation not on record | 2 |
| DBF-NHMDlocation not on record | 2 |
| Kingston, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Feira de Santana, BR | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Glarus, CH | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Flagstaff, US | 1 |
| Waverly, US | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| JBAlocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Boumlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Granada, ES | 1 |
| Pamplona, ES | 1 |
| Porrentruy, CH | 1 |
| WINlocation not on record | 1 |
| Norfolk, US | 1 |
| nbflocation not on record | 1 |
| Coimbra, PT | 1 |
| Elikins, US | 1 |
| Washington, US | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| PRClocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Cambridge, US | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| EL PASO, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| SZUlocation not on record | 1 |
| Phoenix, US | 1 |
| Minia, EG | 1 |
| Frankfurt am Main | 1 |
| University of Hulllocation not on record | 1 |
| Wuzhou, CN | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| GAlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| University of Bayreuthlocation not on record | 1 |
| Boise, US | 1 |
| Oswego, US | 1 |
| Long Beach, US | 1 |
| Madrid, ES | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Jaén, ES | 1 |
212 institutions · 5 916 of 6 468 vouchered records shown · 552 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Drosera intermedia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map4 countries0
bog
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.0 °C 9.80–18.1
Seasonal swing summer↔winter15.0 °C
Max temp (day)20.9 °C 12.9–21.9
Min temp (night)12.8 °C 6.60–14.0
Precipitation85.6 mm/mo 73.9–134
Air humidity62.3 % 60.9–64.7
Moisture balance-20.1 mm/mo -41.4–127
Vapour deficit729 Pa 471–814
Wind speed3.80 m/s 2.80–5.40
Cloud cover41.0 % 35.1–55.6
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.