Drassyllus insularis

(Banks, 1900) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Gnaphosidae/Drassyllus

At a glance

Occurrence records418

Data sources9

Biological traits4

DNA specimens23

eDNA detections14

Sources9 archives

Databases and archives Drassyllus insularis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility418 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

World Spider Trait DBMasaryk University4 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF418 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD23 specimens

01Narrative

Drassyllus insularis is a species of ground spider in the family Gnaphosidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPlatnick & Dondale 1992

Morphometry4

Body length♀5.23·♂4.82 mm

Cephalothorax length♀2.09·♂2.27 mm

Cephalothorax width♀1.57·♂1.77 mm

Femur II length♀1.4·♂1.49 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drassyllus insularis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs8

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

4Amostly conserved

22Avariable

28Gmostly conserved

46Avariable

76Amostly conserved

79Tmostly conserved

82Gvariable

91Amostly conserved

97Amostly conserved

112Gmostly conserved

115Cvariable

131Gmostly conserved

139Gmostly conserved

145Amostly conserved

166Amostly conserved

169Gmostly conserved

175Amostly conserved

184Gmostly conserved

199Amostly conserved

202Tmostly conserved

211Amostly conserved

214Gmostly conserved

217Gmostly conserved

241Gvariable

244Gmostly conserved

253Amostly conserved

271Tmostly conserved

295Cvariable

301Gvariable

304Amostly conserved

313Avariable

355Tmostly conserved

370Amostly conserved

382Gmostly conserved

412Gmostly conserved

415Amostly conserved

430Gmostly conserved

436Amostly conserved

481Gmostly conserved

490Gvariable

499Tmostly conserved

502Gmostly conserved

514Amostly conserved

538Amostly conserved

542Tmostly conserved

550Amostly conserved

577Gvariable

578Tmostly conserved

580Gmostly conserved

619Amostly conserved

622Amostly conserved

AACATTATATTTATTATTTGGATCATGGGCTGCTATAGTAGGAACAGCAATAAGTGTATTAATTCGTATGGAATTAGGTCAGTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes14

BINs8

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drassyllus praeficussame genus8.2%Drassyllus nigersame genus8.5%Drassyllus novussame genus8.9%Drassyllus depressussame genus9.0%Zelotes argoliensissame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type418 records

Wild obs. + sensor6

Museum / vouchered412

Origin

Native6

Range

Area of Occupancy AOO572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 156≤10 km 6>10 km 1

163 georeferenced · 249 without coordinates

Open the institutions mapphysical evidence412

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	153
San Francisco, US	89
San Diego, US	87
Denver, US	49
Albuquerque, US	11
Awka, NG	9
Los Angeles, US	6
Cambridge, US	4
Vancouver, CA	2
Chicago, US	1

10 institutions · 411 of 412 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Drassyllus insularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate GrasslandMixed habitatChaparral

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 12.2–24.6

Seasonal swing summer↔winter21.2 °C

Max temp (day)23.7 °C 18.1–31.0

Min temp (night)10.8 °C 5.30–20.2

Precipitation14.5 mm/mo 2.50–64.5

Air humidity50.4 % 45.2–67.3

Moisture balance-105 mm/mo

Vapour deficit899 Pa 652–1,677

Wind speed2.40 m/s

Cloud cover14.9 % 11.5–37.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)