Drassyllus aprilinus

(Banks, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Gnaphosidae/Drassyllus

At a glance

Occurrence records156

Data sources9

Biological traits4

DNA specimens7

eDNA detections1

Sources9 archives

Databases and archives Drassyllus aprilinus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility156 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

World Spider Trait DBMasaryk University4 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF156 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Drassyllus aprilinus is a species of ground spider in the family Gnaphosidae. It is found in the United States and Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPlatnick & Dondale 1992

Morphometry4

Body length♀4.5·♂3.86 mm

Cephalothorax length♀1.87·♂1.75 mm

Cephalothorax width♀1.4·♂1.36 mm

Femur II length♀1.15·♂1.09 mm

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drassyllus aprilinus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

15Cvariable

21Avariable

27Cvariable

123Gvariable

171Avariable

213Avariable

360Avariable

403Tvariable

411Gvariable

465Avariable

470Cvariable

474Avariable

507Avariable

526Avariable

537Gvariable

546Avariable

552Avariable

558Gvariable

579Gvariable

TTATATTTATTATTCGGCTCATGAGCCGCTATAGTGGGGACTGCTATAAGTGTATTAATTCGTATAGAATTAGGTCAATCTGGGAGATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs2

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drassyllus nigersame genus7.4%Drassyllus novussame genus8.4%Drassyllus praeficussame genus8.6%Drassyllus dromeussame genus8.6%Drassyllus biglobussame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type156 records

Wild obs. + sensor6

Museum / vouchered150

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 9≤1 km 1≤10 km 2

12 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	69
College Station, US	51
Denver, US	14
Chicago, US	11
Cambridge, US	3
University of Indianapolislocation not on record	1
Champaign, US	1

7 institutions · 150 of 150 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Drassyllus aprilinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Mixed deciduous hardwoods

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 17.2–17.2

Seasonal swing summer↔winter26.2 °C

Max temp (day)22.6 °C

Min temp (night)12.1 °C

Precipitation137 mm/mo

Air humidity56.7 %

Moisture balance-15.6 mm/mo

Vapour deficit856 Pa

Wind speed4.30 m/s

Cloud cover39.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)