Drassodes neglectus

(Keyserling, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Gnaphosidae/Drassodes

At a glance

Occurrence records490

Data sources9

Biological traits5

DNA specimens76

eDNA detections75

Sources9 archives

Databases and archives Drassodes neglectus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility490 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI75 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics76 specimens↗

World Spider Trait DBMasaryk University5 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF490 records

Environmental DNA1 datasets · 2 countries75 detections

DNA & barcodingBOLD76 specimens

01Narrative

Drassodes neglectus is a species of ground spider in the family Gnaphosidae. It is found in Russia (Far East) and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPlatnick & Dondale 1992Pekár et al. 2012a

Morphometry4

Body length♀9.51·♂6.54 mm

Cephalothorax length♀3.42·♂2.82 mm

Cephalothorax width♀2.43·♂2.02 mm

Femur II length♀2.41·♂2.3 mm

Predation1

Prey diversity1 mm

05DNA & barcoding76 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Drassodes neglectus has left across the world's sequence archives.

At a glance

DNA specimens76

BINs5

Marker genes1

eDNA detections75

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

69Amostly conserved

78Gmostly conserved

120Gmostly conserved

156Cmostly conserved

198Amostly conserved

312Amostly conserved

315Amostly conserved

342Cvariable

429Amostly conserved

471Amostly conserved

489Gmostly conserved

537Gvariable

540Amostly conserved

558Amostly conserved

564Amostly conserved

600Tmostly conserved

615Tmostly conserved

624Amostly conserved

630Avariable

ACTTTATATTTTTTATTTGGATTATGGTCTTCTATGGTGGGTACGGCTATAAGAGTATTGATTCGTATAGAATTAGGGCAATCTGGAAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes19

BINs5

Most divergent pair4.9%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Drassodes mirussame genus3.7%Drassodes saccatussame genus6.2%Drassodes villosussame genus6.7%Drassodes lapidosussame genus8.1%Drassodes cupreussame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type490 records

Wild obs. + sensor9

Museum / vouchered481

Range

Area of Occupancy AOO1 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 11≤1 km 36≤10 km 47>10 km 3

97 georeferenced · 384 without coordinates

Open the institutions mapphysical evidence481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	248
Royal Saskatchewan Museumlocation not on record	53
Albuquerque, US	40
Cambridge, US	28
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
WIlocation not on record	13
Vancouver, CA	10
University of Alberta Museums (UAM)location not on record	10
Awka, NG	7
Buenos Aires, AR	4
Edmonton, CA	3
Chicago, US	3
Champaign, US	3
Ohio State University Acarology Laboratorylocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
US	2
Helsinki, FI	1
Saint John, CA	1

18 institutions · 451 of 481 vouchered records shown · 30 without an institution code

09Environmental DNA75 detections

Where the DNA of Drassodes neglectus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found75

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 75 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.1. Boreal Forestunder rockMixed habitat4. Native Grassland3. Shrubland | 3.3. Boreal Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 8.60–18.1

Seasonal swing summer↔winter26.9 °C

Max temp (day)18.2 °C 13.8–25.7

Min temp (night)8.60 °C 3.80–11.6

Precipitation80.6 mm/mo 39.3–105

Air humidity56.6 % 50.4–61.9

Moisture balance-51.0 mm/mo -109–-9.20

Vapour deficit670 Pa 466–1,161

Wind speed2.80 m/s 1.80–4.30

Cloud cover41.2 % 29.5–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)