Dracocephalum peregrinum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Dracocephalum

At a glance

Occurrence records636

Data sources9

Biological traits16

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Dracocephalum peregrinum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility636 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF636 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Der Fremdartige Drachenkopf (Dracocephalum peregrinum) ist eine Pflanzenart aus der Gattung der Drachenköpfe (Dracocephalum) in der Familie der Lippenblütler (Lamiaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.7 m

Plant height min0.2 m

Life cycle & reproduction6

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

03Chemical composition26 compounds

Compounds documented for Dracocephalum peregrinum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones10

Lupane triterpenoids6

Bisnaphthalenes $ Naphthoquinones3

Cinnamic acids and derivatives2

Ursane and Taraxastane triterpenoids2

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9R,11aR,11bS,13aR,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
(1R,3aS,5aR,5bR,7aR,9S,11aS,11bS,13aR,13bS)-3a-(hydroxymethyl)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
5-Hydroxy-6-(5-hydroxy-7-methyl-1,4-dioxonaphthalen-2-yl)-2-methoxy-7-methylnaphthalene-1,4-dione	present	NPASS
6-Hydroxyluteolin 6,7,3',4'-tetramethyl ether	present	LOTUS
8-Hydroxy-7-(5-hydroxy-7-methyl-1,4-dioxonaphthalen-2-yl)-2-methoxy-6-methylnaphthalene-1,4-dione	present	NPASS
[(2R,3S,4S,5R,6R)-6-[(R)-cyano(phenyl)methoxy]-3,4,5-trihydroxyoxan-2-yl]methyl acetate	present	LOTUS
[(2S,3R,4R,5R,6R)-5-acetyloxy-4-hydroxy-2-methyl-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-methoxyphenyl)-4-oxochromen-7-yl]oxyoxan-2-yl]methoxy]oxan-3-yl] acetate	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dracocephalum peregrinum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL863061.1 ↗266 bpRussia

ACGT

AATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCG …

Dracocephalum peregrinum voucher Lomonosova s.n. from Russia 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dracocephalum peregrinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 123×CCDB · ipcn-api-dl · CCDB · iapt

CCDB · ipcn-api-dl — Zakirova, R. O. & I. I. Nafanailova. 1988. Chromosome numbers in members of some families of the Kazakhstan flora. Bot. Žhurn. (Moscow & Leningrad) 73: 452–453.

CCDB · ipcn-api-dl — Budantzev, A. L. 1986. Chromosome numbers and some problems in the systematics of the genus Dracocephalum (Lamiaceae). Bot. Zhurn. 71: 1211–1217.

CCDB · iapt — IAPT/IOPB Chromosome Data 20

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.996 ↗

08Occurrence & distribution

Record type636 records

Wild obs. + sensor440

Museum / vouchered193

Cultivated / captive3

Range

Area of Occupancy AOO1 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 116≤1 km 49≤10 km 23>10 km 101

289 georeferenced · 151 without coordinates

Open the mapobservation + sensor440

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤1 km 11≤10 km 15>10 km 11

37 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence193

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	101
Urumqi, CN	26
BRNUlocation not on record	11
Berlin, DE	10
NSMKlocation not on record	10
Frankfurt am Main	6
Wlocation not on record	5
WNNUlocation not on record	4
Yangling, CN	3
Beijing, CN	2
Saint Louis, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Edinburgh, GB	1
University of Hamburglocation not on record	1

14 institutions · 182 of 193 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)