Dollfusentis bravoae

Salgado-Maldonado, 1976 · species

image placeholder — illustration coming later

Animalia/Acanthocephala/Palaeacanthocephala/Echinorhynchida/Illiosentidae/Dollfusentis

At a glance

Occurrence records41

Data sources7

Biological traits2

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Dollfusentis bravoae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

OBISOcean Biodiversity Information System6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS41 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Dollfusentis bravoae is een soort in de taxonomische indeling van de Acanthocephala (haakwormen). De worm wordt meestal 1 tot 2 cm lang. Ze komen algemeen voor in het maag-darmstelsel van ongewervelden, vissen, amfibieën, vogels en zoogdieren. De haakworm komt uit het geslacht Dollfusentis en behoort tot de familie Illiosentidae. Dollfusentis bravoae werd in 1976 beschreven door Guillermo Salgado-Maldonado.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonehost

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dollfusentis bravoae has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P673 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

131Gvariable

161Cvariable

224Gmostly conserved

338Gvariable

350Amostly conserved

370Amostly conserved

371Cmostly conserved

423Tmostly conserved

440Gmostly conserved

467Tvariable

503Cvariable

515Gmostly conserved

539Avariable

549Tmostly conserved

563Cvariable

666Tmostly conserved

AGGATATTGGGTTGTATTATTTTATAGTTAGATTATGAGGGGGTTTGGTTGGGTTTAGGTTAAGACTTTTAATTCGGTTAGAACTAGGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes4

BIN1

Most divergent pair1.2%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor6

Museum / vouchered35

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 30≤10 km 5

35 georeferenced

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	31
Mexico City, MX	4

2 institutions · 35 of 35 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Dollfusentis bravoae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 15.7–26.8

Seasonal swing summer↔winter7.40 °C

Max temp (day)26.3 °C 22.0–30.6

Min temp (night)16.4 °C 9.00–23.8

Precipitation72.0 mm/mo 34.7–109

Air humidity55.1 % 50.9–59.2

Moisture balance-66.5 mm/mo -93.3–-39.7

Vapour deficit1,161 Pa 884–1,437

Wind speed3.00 m/s 2.00–4.10

Cloud cover27.1 % 25.5–28.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)