Dolichopus griseipennis

Stannius, 1831 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Dolichopodidae/Dolichopus

At a glance

Occurrence records1 967

Data sources9

Biological traits2

DNA specimens131

eDNA detections7

Sources9 archives

Databases and archives Dolichopus griseipennis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 967 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics131 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 967 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD131 specimens

Genome at a glanceGoaT · NCBI≈898 Mbp

01Narrative

Dolichopus griseipennis is a species of fly in the family Dolichopodidae. It is found in the Palearctic.Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Parent, O. (1938) Diptères Dolichopodidae. Paris: Éditions Faune de France 35 . 720 p., 1. 002 fig. (FdeFr35)Dipt.Dolochopodidae.pdf Bibliotheque Virtuelle Numerique pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding131 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dolichopus griseipennis has left across the world's sequence archives.

At a glance

DNA specimens131

BINs1

Marker genes2

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus119 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

41Gmostly conserved

83Gmostly conserved

104Tvariable

164Avariable

203Cmostly conserved

236Tmostly conserved

314Amostly conserved

344Tmostly conserved

374Cvariable

410Gmostly conserved

431Amostly conserved

470Amostly conserved

488Cmostly conserved

494Amostly conserved

506Gmostly conserved

620Amostly conserved

635Cmostly conserved

CTTTATATTTCATTTTTGGAGCTTGAGCAGGTATAGTGGGGACATCTCTTAGTATTATTGTTCGAGCAGAATTAGGACACCCGGGAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 84 variants.

Diversity (π)1.1%

Haplotypes84

BIN1

Most divergent pair12.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichopus setifersame genus8.7%Dolichopus ovatussame genus8.7%Dolichopus flagellitenenssame genus9.0%Dolichopus finitussame genus9.0%Dolichopus brevimanussame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Dolichopus griseipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈897 527 385 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dolichopus griseipennis0.90 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness91.3% BUSCO

08Occurrence & distribution

Record type1 967 records

Wild obs. + sensor1 298

Museum / vouchered669

Range

Area of Occupancy AOO3 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 723≤1 km 167≤10 km 398

1 288 georeferenced · 10 without coordinates

Open the mapobservation + sensor1 298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 209≤1 km 99≤10 km 213

521 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence669

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	121
Naturalis (NL)location not on record	98
RBINS (BE)location not on record	91
NCMGlocation not on record	66
Stockholm, SE	65
SLU Artdatabankenlocation not on record	42
DFFW2016location not on record	32
DFFW2018location not on record	13
Naturalis (previous Rijksmuseum van Natuurlijke Historie) (NL)location not on record	12
NHMOlocation not on record	10
Gothenburg, SE	9
Helsinki, FI	9
South Kensington, GB	9
DFFW1981location not on record	8
Natural History Museum, Londonlocation not on record	6
CBDClocation not on record	5
SGAV-and-NHMDlocation not on record	4
Wellcome Sanger Institutelocation not on record	4
Natuurhistorisch Museum Maastricht (NL)location not on record	3
BioFokuslocation not on record	2
DFlocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Tilburg, NL	1

23 institutions · 612 of 669 vouchered records shown · 57 without an institution code

09Environmental DNA7 detections

Where the DNA of Dolichopus griseipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 11.7–15.9

Seasonal swing summer↔winter12.7 °C

Max temp (day)17.7 °C 14.9–19.6

Min temp (night)10.4 °C 8.50–11.9

Precipitation58.6 mm/mo 57.0–64.4

Air humidity62.4 % 61.3–65.1

Moisture balance-19.5 mm/mo -40.1–5.60

Vapour deficit606 Pa 483–702

Wind speed4.40 m/s 4.20–4.80

Cloud cover45.1 % 42.2–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dolichopus griseipennis

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 967 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 967 records