Dolichopus festivus

Haliday, 1832 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Dolichopodidae/Dolichopus

At a glance

Occurrence records1 120

Data sources7

Biological traits2

DNA specimens319

eDNA detections2

Sources7 archives

Databases and archives Dolichopus festivus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics319 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 120 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD319 specimens

01Narrative

Dolichopus festivus is a species of long-legged fly in the family Dolichopodidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding319 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dolichopus festivus has left across the world's sequence archives.

At a glance

DNA specimens319

BINs1

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus312 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

176Tmostly conserved

200Amostly conserved

269Cvariable

326Amostly conserved

563Amostly conserved

632Cmostly conserved

CTTTATATTTCATTTTTGGGGCTTGAGCGGGTATAGTGGGAACATCTCTTAGTATTATTGTTCGAGCAGAACTAGGTCATCCAGGAGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 48 variants.

Diversity (π)0.32%

Haplotypes48

BIN1

Most divergent pair0.92%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichopus arbustorumsame genus7.0%Dolichopus armillatussame genus9.0%Dolichopus stenhammarisame genus9.0%Dolichopus packardisame genus9.2%Dolichopus groenlandicussame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 120 records

Wild obs. + sensor817

Museum / vouchered303

Range

Area of Occupancy AOO2 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 458≤1 km 109≤10 km 248

815 georeferenced · 2 without coordinates

Open the mapobservation + sensor817

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 110≤1 km 42≤10 km 120

272 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence303

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DFFW2016location not on record	53
Naturalis (NL)location not on record	51
NCMGlocation not on record	39
SLU Artdatabankenlocation not on record	13
DFFW2018location not on record	11
MZLUlocation not on record	10
Stockholm, SE	10
Gothenburg, SE	10
South Kensington, GB	9
Naturalis (previous Rijksmuseum van Natuurlijke Historie) (NL)location not on record	8
Tilburg, NL	6
Natuurmuseum Nijmegen (NL)location not on record	5
RBINS (BE)location not on record	4
CBDClocation not on record	4
DFFW1981location not on record	4
Natural History Museum, Londonlocation not on record	3
SGAV-and-NHMDlocation not on record	3
Wellcome Sanger Institutelocation not on record	1
BioFokuslocation not on record	1

19 institutions · 245 of 303 vouchered records shown · 58 without an institution code

09Environmental DNA2 detections

Where the DNA of Dolichopus festivus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter12.8 °C

Max temp (day)13.6 °C

Min temp (night)6.70 °C

Precipitation50.4 mm/mo

Air humidity63.2 %

Moisture balance-20.5 mm/mo

Vapour deficit495 Pa

Wind speed4.60 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dolichopus festivus

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 120 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 120 records