Dolichopus comatus

Loew, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Dolichopodidae/Dolichopus

At a glance

Occurrence records410

Data sources7

Biological traits0

DNA specimens302

eDNA detections302

Sources7 archives

Databases and archives Dolichopus comatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI302 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics302 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 2 countries302 detections

DNA & barcodingBOLD302 specimens

01Narrative

Dolichopus comatus is a species of long-legged fly in the family Dolichopodidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding302 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dolichopus comatus has left across the world's sequence archives.

At a glance

DNA specimens302

BINs1

Marker genes1

eDNA detections302

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus293 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

79Amostly conserved

88Tmostly conserved

181Amostly conserved

202Tmostly conserved

271Tmostly conserved

283Cmostly conserved

316Amostly conserved

343Gmostly conserved

364Tmostly conserved

433Avariable

496Amostly conserved

565Amostly conserved

622Amostly conserved

625Amostly conserved

AACTTTATATTTTATCTTTGGGGCTTGAGCAGGTATAGTGGGAACATCTCTTAGTATTATTGTTCGAGCAGAATTAGGACACCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 134 variants.

Diversity (π)1.7%

Haplotypes134

BIN1

Most divergent pair2.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichopus virgasame genus6.5%Dolichopus agronomussame genus6.8%Dolichopus sincerussame genus7.4%Dolichopus finitussame genus7.4%Dolichopus nitidussame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type410 records

Wild obs. + sensor137

Museum / vouchered273

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 78≤1 km 22≤10 km 4>10 km 11

115 georeferenced · 22 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 18

23 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence273

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	184
Chicago, US	15
Cambridge, US	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
University Park, US	4
University of Guelphlocation not on record	3
Natural History Museum of Utahlocation not on record	3
CUlocation not on record	1

8 institutions · 220 of 273 vouchered records shown · 53 without an institution code

09Environmental DNA302 detections

Where the DNA of Dolichopus comatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found302

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 302 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.5 Urban AreasForestCarex MeadowUrban5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 15.1–19.4

Seasonal swing summer↔winter27.7 °C

Max temp (day)18.1 °C 18.1–24.4

Min temp (night)13.7 °C 11.1–17.7

Precipitation93.3 mm/mo 80.1–93.6

Air humidity58.3 % 57.7–59.5

Moisture balance-60.0 mm/mo -60.2–-31.4

Vapour deficit732 Pa 685–914

Wind speed6.70 m/s 2.90–6.70

Cloud cover43.1 % 39.4–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 302 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)