Dolichopus atratus

Meigen, 1824 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Dolichopodidae/Dolichopus

At a glance

Occurrence records1 084

Data sources6

Biological traits2

DNA specimens12

eDNA detections0

Sources6 archives

Databases and archives Dolichopus atratus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 084 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 084 records

DNA & barcodingBOLD12 specimens

01Narrative

Dolichopus atratus is a species of fly in the family Dolichopodidae. It is found in the Palearctic.Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Parent, O. (1938) Diptères Dolichopodidae. Paris: Éditions Faune de France 35 . 720 p., 1. 002 fig. (FdeFr35)Dipt.Dolochopodidae.pdf Bibliotheque Virtuelle Numerique pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dolichopus atratus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

20Amostly conserved

53Amostly conserved

182Amostly conserved

233Tmostly conserved

320Gvariable

410Tvariable

CCTTGTATTTCATCTTTGGAGCTTGAGCAGGTATAGTGGGAACATCTCTTAGAATTATTATTCGAGCAGAATTAGGCCACCCTGGTGCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dolichopus lamellipessame genus8.9%Dolichopus brevimanussame genus9.0%Dolichopus armillatussame genus9.0%Dolichopus arbustorumsame genus9.2%Gymnopternus nigribarbussame family9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 084 records

Wild obs. + sensor873

Museum / vouchered211

Range

Area of Occupancy AOO1 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 592≤1 km 201≤10 km 76

869 georeferenced · 4 without coordinates

Open the mapobservation + sensor873

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 100≤1 km 29≤10 km 78

207 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Naturalis (NL)location not on record	45
DFlocation not on record	35
CBDClocation not on record	24
RBINS (BE)location not on record	22
DFFW2018location not on record	12
Naturalis (previous Rijksmuseum van Natuurlijke Historie) (NL)location not on record	7
NCMGlocation not on record	7
South Kensington, GB	6
Tilburg, NL	5
DFFW1981location not on record	2
DFFW2016location not on record	2
Natural History Museum, Londonlocation not on record	1

12 institutions · 168 of 211 vouchered records shown · 43 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dolichopus atratus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 084 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 12 geolocated

Record type1 084 records