Dodonaea polyandra

Merr. & L.M.Perry · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Dodonaea

At a glance

Occurrence records488

Data sources9

Biological traits23

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Dodonaea polyandra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Chemical compositionLOTUS · NPASS69 compounds

Occurrence & distributionGBIF488 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Dodonaea polyandra là một loài thực vật có hoa trong họ Bồ hòn. Loài này được Merr. & L.M.Perry mô tả khoa học đầu tiên năm 1940.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length22 mm

Fruit width22.5 mm

Leaf length105 mm

Leaf width42 mm

Petiole length0.65 cm

Plant height8 m

Seed length2 mm

Seed mass4.76 mg

Seed mass max4.76 mg

Seed mass min4.76 mg

Seed width2.5 mm

Life cycle & reproduction4

Flowering timeyyyyyynnnnnn

Life formshrub or tree

Life spanperennial

Sex typedioecious

Habitat & environment7

Climatewet tropical

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical obovate

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition69 compounds

Compounds documented for Dodonaea polyandra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols10

Colensane and Clerodane diterpenoids7

Unsaturated fatty acids5

Fatty aldehydes4

Labdane diterpenoids3

Documented compounds69 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Linalool	present	NPASS
(1S,5R,6S,13R,21S)-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.7.1.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaene-6,9,17,19,21-pentol	present	NPASS
(1S,5S,6R,13R,21S)-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.7.1.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaene-6,9,17,19,21-pentol	present	NPASS
(2E)-3-(4-methylbenzenesulfonyl)prop-2-enenitrile	present	NPASS
(2R)-2-methylbutanoic acid	present	NPASS
(2S,4aR,5S,8aR)-5-[2-(furan-3-yl)ethyl]-1,1,4a,6-tetramethyl-2,3,4,5,8,8a-hexahydronaphthalen-2-ol	present	LOTUS
(3R,4aR,5R,6R,8aS)-3-benzoyloxy-5-[2-(furan-3-yl)ethyl]-5,6,8a-trimethyl-3,4,4a,6,7,8-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(3R,4aR,5S,6R,8aS)-6-(benzoyloxymethyl)-5-[2-(furan-3-yl)ethyl]-3-hydroxy-5,8a-dimethyl-3,4,4a,6,7,8-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(4aR,5S,6R,8aS)-6-(benzoyloxymethyl)-5-[2-(furan-3-yl)ethyl]-5,8a-dimethyl-3,4,4a,6,7,8-hexahydronaphthalene-1-carboxylic acid	present	LOTUS
(4aS,5S,6S,8aS)-6-(benzoyloxymethyl)-5-[2-(furan-3-yl)ethyl]-5,8a-dimethyl-3,4,4a,6,7,8-hexahydronaphthalene-1-carboxylic acid	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dodonaea polyandra has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSFJ375185.1 ↗608 bp

ACGT

TCGAAACCTGCACAGCAGAACGACCCGCGAACCTGTTTCATCACACGGGGGGCGACCCCCACCCGCCGTCGGCGGCAGGGCGTCCCTCGG …

Dodonaea polyandra internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type488 records

Wild obs. + sensor13

Museum / vouchered424

Cultivated / captive1

Other50

Origin

Native16

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 10≤1 km 1≤10 km 2

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 93≤1 km 50≤10 km 127>10 km 12

282 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence424

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	146
Smithfield, AU	98
Canberra, AU	44
Palmerston, AU	24
Museo Entomologico de Leonlocation not on record	21
Kew, GB	18
Mount Annan, AU	9
Adelaide, AU	9
Armidale, AU	9
James Cook Townsvillelocation not on record	5
University of Stellenboschlocation not on record	3
Saint Louis, US	2
Kensington, AU	1
Honolulu, US	1
Auckland, NZ	1

15 institutions · 391 of 424 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dodonaea polyandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)