Dodonaea platyptera

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Dodonaea

At a glance

Occurrence records496

Data sources8

Biological traits28

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Dodonaea platyptera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility496 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF496 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Dodonaea platyptera là một loài thực vật có hoa trong họ Bồ hòn. Loài này được F.Muell. mô tả khoa học đầu tiên năm 1858.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length11 mm

Fruit width25 mm

Leaf length69 mm

Leaf width24 mm

Petiole length0.9 cm

Plant height6 m

Plant height max6 m

Plant height min1 m

Seed length2 mm

Seed mass6.98 mg

Seed width2.5 mm

Life cycle & reproduction5

Flowering timeyynnnnnnnnyy

Life formshrub or tree

Life spanperennial

Resprouting capacityfire_killed

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dodonaea platyptera has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSHM205077.1 ↗609 bp

ACGT

TCGAAACCTGCACAGCAGAACGACCCGTGAACTTGTTTCATCACATGGGGGGCAACCCCCACCTGTCGTCGGTGGTAGGGCGTCCTTGGG …

Dodonaea platyptera internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type496 records

Wild obs. + sensor190

Museum / vouchered284

Cultivated / captive16

Other6

Origin

Native16

Range

Area of Occupancy AOO1 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 90≤1 km 8≤10 km 2

100 georeferenced · 90 without coordinates

Open the mapobservation + sensor190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 45≤1 km 27≤10 km 123>10 km 10

205 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence284

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy87% within 1 km

≤1 km 13≤10 km 1>10 km 1

15 georeferenced · 1 without coordinates

Open the mapnot free-living16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	80
Brisbane, AU	53
Canberra, AU	39
Smithfield, AU	38
Kensington, AU	28
Museo Entomologico de Leonlocation not on record	20
Adelaide, AU	8
Mount Annan, AU	4
BGPAlocation not on record	2
James Cook Townsvillelocation not on record	2
Kew, GB	2
University of Stellenboschlocation not on record	1

12 institutions · 277 of 284 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dodonaea platyptera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)