Distichlis spicata
(L.) Greene · speciesAt a glance
Occurrence records10 778
Data sources12
Biological traits100
DNA specimens39
eDNA detections22
Sources12 archives
Databases and archives Distichlis spicata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 770 records↗
OBISOcean Biodiversity Information System8 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources100 traits
Occurrence & distributionGBIF · OBIS10 778 records
Environmental DNA1 datasets · 3 countries22 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB2n = 40
01Narrative
Distichlis spicata est une plante appartenant à la famille des Poaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height0.34 m
Seed mass0.499 mg
⚠ sources differ — TRY: 0.499 mg · GIFT: 0.663 mg
Seed mass max0.548 mg
Seed mass min0.356 mg
Life cycle & reproduction25
After harvest regrowth rateSlow
Bloom periodMid Summer
Coppice potentialNo
Flower colouryellow
Flower conspicuousNo
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDASlow
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 600 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassYes
Mycorrhiza typearbuscular
Root depth min2 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min80 days
Leaf n14.46 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC4
Precipitation max70 in
Precipitation min5 in
Protein potentialLow
Salinity toleranceHigh
Shade toleranceHigh
Soil pH max10 pH
Soil pH min6.4 pH
Specific leaf area (SLA)14.97 mm²/mg
Temperature min-35 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound519 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max43 000 per acre
Planting density min11 000 per acre
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Distichlis spicata has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes10
GenBank sequences10
eDNA detections22
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTCATGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCAA …
Distichlis spicata voucher MONT:87465 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL3★rbcLa★ITS2★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Distichlis spicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidypolyploid inferred
Chromosome records14–402n range40median40mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4011×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981. In Chromosome number reports LXX. Taxon 30: 72.
CCDB · book-ipcn67-71 — REEDER, J. R. 1967. Notes on Mexican grasses VI. Miscellaneous chromosome numbers. Bull. To'rrey Bot. Club. 94: 1-17.
CCDB · book-ipcn67-71 — REEDER, J. R., & D. N. SINGH. 1967. In IOPB chromosome number reports XI. Tax on 16: 215-222.
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
CCDB · book-fedorov — Stebbins, Love 1941
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-fedorov — Rahn 1960
CCDB · book-fedorov — Bowden 1960a
CCDB · book-atlas-flowering-plants — Stebbins & L. 1941
CCDB · book-atlas-flowering-plants — Fo
2n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Murray, B. G. 1976. The cytology of the genus Briza L. (Gramineae). II. Chiasma frequency, polyploidy and interchange heterozygosity. Chromosoma 57: 81–93.
2n 201×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 21
n 191×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 21
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type10 778 records
Wild obs. + sensor6 330
Museum / vouchered4 430
Other18
Origin
Native76
Introduced1
Range
Area of Occupancy AOO23 136 km²
Depth
0–200 m sunlit8
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1 m · max 1 m · 8 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy93% within 1 km
≤100 m 4 007≤1 km 490≤10 km 187>10 km 149
4 833 georeferenced · 1 497 without coordinates
Open the mapobservation + sensor6 330
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 512≤1 km 704≤10 km 1 001>10 km 204
2 421 georeferenced · 2 009 without coordinates
Open the institutions mapphysical evidence4 430
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions144 of 220 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| San Diego, US | 281 |
| Wuzhou, CN | 227 |
| Claremont, US | 177 |
| Santa Barbara, US | 166 |
| Riverside, US | 161 |
| Davis, US | 136 |
| WTUlocation not on record | 110 |
| Austin, US | 99 |
| Philadelphia, US | 91 |
| University of Stellenboschlocation not on record | 86 |
| Bronx, US | 86 |
| Corvallis, US | 84 |
| San Luis Obispo, US | 74 |
| Pullman, US | 72 |
| Durango, MX | 69 |
| Saint Louis, US | 67 |
| Logan, US | 66 |
| ASUlocation not on record | 66 |
| US | 64 |
| Flagstaff, US | 57 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 56 |
| Albuquerque, US | 52 |
| Bloomington, US | 49 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 48 |
| Tampa, US | 47 |
| Arcata, US | 44 |
| Canadian Department of Agriculturelocation not on record | 41 |
| New Haven, US | 40 |
| St. Paul, US | 39 |
| Chongqing Museumlocation not on record | 37 |
| Missoula, US | 37 |
| University of New Hampshirelocation not on record | 37 |
| Chadron, US | 36 |
| Bangkok, TH | 36 |
| College Park, US | 35 |
| CASlocation not on record | 33 |
| Mexico City, MX | 32 |
| Fort Worth, US | 31 |
| University of Alberta Museumslocation not on record | 31 |
| Mexico City, MX | 31 |
| Spearfish, US | 31 |
| Ann Arbor, US | 30 |
| Burlington, US | 30 |
| Williamsburg, US | 28 |
| Denver, US | 27 |
| Acadia Universitylocation not on record | 26 |
| Kew, GB | 25 |
| Guasave, MX | 25 |
| Irvine, US | 24 |
| Córdoba, AR | 23 |
| Phoenix, US | 22 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 21 |
| EL PASO, US | 21 |
| Severin-McDaniel Insect Collectionlocation not on record | 19 |
| Jena Microbial Resource Collectionlocation not on record | 19 |
| Fredericton Stock Culture Collectionlocation not on record | 19 |
| Hermosillo, MX | 17 |
| Miami, US | 16 |
| Staten Island, US | 16 |
| Austin, US | 16 |
| Provo, US | 16 |
| US | 15 |
| Grand Junction, US | 15 |
| Pocatello, US | 14 |
| Chapel Hill, US | 14 |
| Bozeman, US | 14 |
| Moscow, US | 13 |
| Saint John, CA | 13 |
| University of Southern Mississippilocation not on record | 13 |
| Bend, US | 13 |
| Caldwell, US | 12 |
| Mexico City, MX | 12 |
| UChlocation not on record | 12 |
| Chicago, US | 11 |
| Santa Cruz, US | 11 |
| Victoria, CA | 11 |
| Lincoln, US | 11 |
| San Angelo, US | 11 |
| GAlocation not on record | 11 |
| BAYLUlocation not on record | 10 |
| Henderson, US | 10 |
| Xiamen, CN | 10 |
| Auckland, NZ | 9 |
| DOI/NPS, Greenbelt Parklocation not on record | 9 |
| Ensenada, MX | 9 |
| La Paz, MX | 9 |
| Norfolk, US | 9 |
| Tacoma, US | 9 |
| San Jose, US | 8 |
| Durham, US | 8 |
| Dresden, DE | 8 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 8 |
| Karlsruhe, DE | 8 |
| Chapingo, MX | 8 |
| The University of Arizonalocation not on record | 7 |
| Catalina Island Conservancylocation not on record | 7 |
| Orem, US | 7 |
| Jackson, US | 7 |
| Zapopan, MX | 7 |
| International Salmonella Centre (W.H.O.)location not on record | 7 |
| Boise, US | 6 |
| Dekalb, US | 6 |
| Canberra, AU | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| Ciudad de México, MX | 6 |
| Eastern Nevada Landscape Coalitionlocation not on record | 6 |
| Lubbock, US | 6 |
| Columbia, US | 6 |
| Mérida, MX | 6 |
| Culiacán, MX | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Northridge, US | 5 |
| Arizona State University Biocollectionslocation not on record | 5 |
| Torreón, MX | 5 |
| Aarhus, DK | 5 |
| Madison, US | 5 |
| Bandelier National Monumentlocation not on record | 5 |
| Oskarshamn, SE | 5 |
| Cambridge, US | 5 |
| Long Beach, US | 5 |
| Weber State Universitylocation not on record | 5 |
| Millersville, US | 5 |
| Bureau of Land Management, Medford District Officelocation not on record | 4 |
| Ciudad Juárez, MX | 4 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| BClocation not on record | 4 |
| San Francisco de Campeche, MX | 4 |
| Montecillo, Texcoco, MX | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Wlocation not on record | 4 |
| Tempe, US | 4 |
| Hobart, AU | 4 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Pittsburg, US | 3 |
| Vancouver, CA | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Cheney, US | 3 |
| Texas A&M Universitylocation not on record | 3 |
| Whitehorse, CA | 3 |
| Dover, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| San Luis Potosí, MX | 3 |
| DanBIFlocation not on record | 3 |
| Edinburgh, GB | 3 |
| Montréal, CA | 3 |
| MAlocation not on record | 3 |
| Tuscaloosa, US | 3 |
| Zacatecas, MX | 3 |
| Calabar, NG | 3 |
| Mazatlán, MX | 3 |
| Clemson, US | 3 |
| Los Angeles, US | 3 |
| Little Rock, US | 2 |
| Mérida, MX | 2 |
| New Mexico State Universitylocation not on record | 2 |
| Juriquilla, MX | 2 |
| MeiseBGlocation not on record | 2 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Christchurch, NZ | 2 |
| AUAlocation not on record | 2 |
| Ciudad de México, MX | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| WINlocation not on record | 2 |
| Kingston, US | 2 |
| Honolulu, US | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| Macomb, US | 2 |
| Beijing, CN | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| San Isidro, AR | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| Mississippi State, US | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Berlin, DE | 1 |
| Antiguo Cuscatlán, SV | 1 |
| La Paz, BO | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| LDlocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Ashland, US | 1 |
| Emporia, US | 1 |
| Keene State Universitylocation not on record | 1 |
| Brasília, BR | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Quito, EC | 1 |
| University of Central Missourilocation not on record | 1 |
| VALElocation not on record | 1 |
| Castelar, AR | 1 |
| XALlocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| TLAXlocation not on record | 1 |
| USFSlocation not on record | 1 |
| STNFlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Elocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| BISHlocation not on record | 1 |
| Ixtacuixtla de Mariano Matamoros, MX | 1 |
| Knoxville, US | 1 |
| Fargo, US | 1 |
| Tapachula, MX | 1 |
| Fort Bragg, US | 1 |
| Durango, US | 1 |
| Chicago, US | 1 |
| Waverly, US | 1 |
| Stockholm, SE | 1 |
| Salamanca, ES | 1 |
| Angwin, US | 1 |
| Minia, EG | 1 |
| QVMAGlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
220 institutions · 4 215 of 4 430 vouchered records shown · 213 without an institution code
09Environmental DNA22 detections
Where the DNA of Distichlis spicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 11.1–19.1
Seasonal swing summer↔winter15.7 °C
Max temp (day)21.2 °C 16.8–24.9
Min temp (night)11.7 °C 7.70–12.3
Precipitation47.5 mm/mo 23.6–78.0
Air humidity54.7 % 50.4–63.4
Moisture balance-82.8 mm/mo -104–-19.4
Vapour deficit808 Pa 561–1,101
Wind speed2.90 m/s 1.90–4.20
Cloud cover36.1 % 27.2–42.5
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.