Distichia muscoides

Nees & Meyen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Juncaceae/Distichia

At a glance

Occurrence records549

Data sources7

Biological traits14

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Distichia muscoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility549 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF549 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Distichia muscoides is a species of plant in the rush family Juncaceae. It is native to the Andes of South America where it grows in upland wetland areas known as bofedales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.013 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 630 m

Elevation min3 600 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Leaf dry-matter content (LDMC)264 mg/g

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Distichia muscoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAY727784.1 ↗573 bp

ACGT

TCGAGACCCTGAACTGGATGACCCGTGCACAGTGATGGAACCAGCCGGGGTGGTGTTACCGCCTCGGCCCCGCGTAGCCCTCATGCCTGC …

Distichia muscoides voucher E.H. Roalson 1447 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type549 records

Wild obs. + sensor231

Museum / vouchered318

Origin

Native12

Range

Area of Occupancy AOO888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 109≤1 km 18≤10 km 21>10 km 8

156 georeferenced · 75 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 9≤1 km 6≤10 km 67>10 km 7

89 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbario de la Universidad Tecnológica Indoaméricalocation not on record	53
Xiamen, CN	50
Saint Louis, US	43
Aarhus, DK	34
Universidad Nacional de Colombia (UNAL)location not on record	26
Kew, GB	12
Quito, EC	11
Wuzhou, CN	6
PRClocation not on record	4
MAlocation not on record	4
QCNElocation not on record	3
Stockholm, SE	3
Loja, EC	3
Universiti Sains Malaysialocation not on record	3
University of Stellenboschlocation not on record	3
La Paz, BO	3
UChlocation not on record	2
HUPCHlocation not on record	2
Chicago, US	2
Chongqing Museumlocation not on record	2
Bronx, US	2
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2
Bloomington, US	1
Universidad de Caldas (UCaldas)location not on record	1
Santa Cruz de la Sierra, BO	1
LDlocation not on record	1
Tampa, US	1
Edmonton, CA	1
San Isidro, AR	1
UFPIlocation not on record	1
Riobamba, EC	1
WAGlocation not on record	1
Cusco, PE	1
University of Alberta Museumslocation not on record	1
Fundación Miguel Lillolocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

37 institutions · 288 of 318 vouchered records shown · 30 without an institution code

09Environmental DNA2 detections

Where the DNA of Distichia muscoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)