Discostroma corticola

(Fuckel) Brockmann · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Amphisphaeriales/Sporocadaceae/Discostroma

At a glance

Occurrence records196

Data sources8

Biological traits0

DNA specimens0

eDNA detections22

Sources8 archives

Databases and archives Discostroma corticola's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility196 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF196 records

Environmental DNA2 datasets · 13 countries22 detections

DNA & barcodingNCBIsequences

01Narrative

Discostroma corticola is a plant pathogen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Discostroma corticola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections22

Countries13

The DNA barcodea real sequence read deposited for this species

ITSPP276953.1 ↗261 bpSpain · 2018

ACGT

AGCGCCAATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAGCCTACTGTATTGTA …

Seimatosporium lichenicola isolate SV-2018-37.3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type196 records

Wild obs. + sensor142

Museum / vouchered54

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 60≤1 km 14≤10 km 68

142 georeferenced

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 9≤1 km 2≤10 km 13>10 km 1

25 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	10
WU-MYClocation not on record	7
SLU Artdatabankenlocation not on record	6
Auckland, NZ	5
Bronx, US	3
Uppsala, SE	3
BDBClocation not on record	2
Olocation not on record	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
TROMlocation not on record	1
Zürich, CH	1
CA	1
Kew, GB	1
MeiseBGlocation not on record	1
GZUlocation not on record	1
Karlsruhe, DE	1
Uniwersytet Łódzkilocation not on record	1

17 institutions · 48 of 54 vouchered records shown · 6 without an institution code

09Environmental DNA22 detections

Where the DNA of Discostroma corticola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys2

Countries13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map13 countries0

AfrotropicNeotropicAustralasiaIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 19.4–25.5

Seasonal swing summer↔winter1.90 °C

Max temp (day)26.2 °C 22.6–28.7

Min temp (night)20.3 °C 14.8–23.0

Precipitation226 mm/mo 129–293

Air humidity68.7 % 61.6–72.3

Moisture balance75.7 mm/mo 7.60–165

Vapour deficit879 Pa 691–1,037

Wind speed1.60 m/s 0.7–4.20

Cloud cover46.7 % 24.5–67.8

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)