Disciotis venosa

(Pers.) Arnould · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Morchellaceae/Disciotis

At a glance

Occurrence records3 143

Data sources11

Biological traits0

DNA specimens3

eDNA detections48

Sources11 archives

Databases and archives Disciotis venosa's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.04 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF3 143 records

Environmental DNA4 datasets · 4 countries48 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT40 Mbp

01Narrative

Disciotis venosa, commonly known as the bleach cup, veiny cup fungus, or the cup morel is a species of fungus in the family Morchellaceae. Fruiting in April and May, they are often difficult to locate because of their nondescript brown color. Found in North America and Europe, they appear to favor banks and slopes and sheltered sites. Although D. venosa is considered edible, it may resemble several other species of brown cup fungi of unknown edibility.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Disciotis venosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aminoacids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Methylhydrazine		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disciotis venosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections48

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOR229387.1 ↗443 bpUSA · 2022

ACGT

GGGGGGGGTCCACCAGAAAACCTCTCAAGAAAACCGCCGTCAGAACATGCAAACAAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGG …

Disciotis venosa voucher FLAS-F-71680 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Disciotis venosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size39 735 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Disciotis venosa0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type3 143 records

Wild obs. + sensor2 780

Museum / vouchered350

Cultivated / captive1

Other12

Origin

Native2

Introduced1

Range

Area of Occupancy AOO6 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 642≤1 km 246≤10 km 1 277>10 km 118

2 283 georeferenced · 497 without coordinates

Open the mapobservation + sensor2 780

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 21≤1 km 87≤10 km 37>10 km 14

159 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence350

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	54
Karlsruhe, DE	17
San Sebastián, ES	17
WU-MYClocation not on record	16
GJOlocation not on record	14
Uppsala, SE	12
Catholic University of Pekinglocation not on record	12
Vitoria, ES	11
Kew, GB	11
Copenhagen, DK	10
Olocation not on record	10
Philadelphia, US	10
MeiseBGlocation not on record	8
Salzburg, AT	7
SLU Artdatabankenlocation not on record	7
BDBClocation not on record	6
Bernard Price Institute for Palaeontological Researchlocation not on record	5
Bardejov, SK	5
FLASlocation not on record	5
Bronx, US	4
Davis and Elkins Collegelocation not on record	4
Toronto, CA	4
Pullman, US	4
Trondheim, NO	4
LDlocation not on record	4
University of Tennessee at Chattanoogalocation not on record	4
Görlitz, DE	4
WTUlocation not on record	3
Göteborg, SE	3
Staten Island, US	2
Tilburg, NL	2
Berlin, DE	2
Université de Montréal Biodiversity Centrelocation not on record	1
Champaign, US	1
Museo Entomologico de Leonlocation not on record	1
Mlocation not on record	1
University of the Basque Country (UPV/EHU)location not on record	1
Bando, JP	1
Laramie, US	1
MAlocation not on record	1
PRClocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1

43 institutions · 292 of 350 vouchered records shown · 57 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA48 detections

Where the DNA of Disciotis venosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys4

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 6.20–17.4

Seasonal swing summer↔winter21.9 °C

Max temp (day)17.9 °C 8.80–21.1

Min temp (night)9.80 °C 3.90–15.0

Precipitation72.2 mm/mo 59.5–93.0

Air humidity61.9 % 59.0–66.1

Moisture balance-1.40 mm/mo -41.8–57.3

Vapour deficit609 Pa 343–781

Wind speed3.00 m/s 2.50–4.60

Cloud cover38.6 % 36.2–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Disciotis venosa

At a glance

Sources11 archives

Compound class profile1 class

Documented compounds1 total

At a glance

Genome sizehow big the whole instruction manual is

Record type3 143 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 143 records