Discina ancilis

(Pers.) Sacc. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Discinaceae/Discina

At a glance

Occurrence records1 746

Data sources10

Biological traits0

DNA specimens0

eDNA detections2

Sources10 archives

Databases and archives Discina ancilis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 746 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 746 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈46 Mbp

01Narrative

Discina perlata, commonly known as pig's ears is a brown to tannish, wrinkled, cup- or ear-shaped fungus, sometimes with short, stout stalk. The spores of D. perlata are quite similar to those of mushrooms in the genus Gyromitra, so that some mycologists classify it there.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Discina ancilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aminoacids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Methylhydrazine		present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Discina ancilis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX576112.1 ↗785 bpMontenegro · 2007

ACGT

CTCCCCCGCGGACCGTTCACGCGGTTTTTGGTCCTCCTCTTCCCTCCAACAAGTAAAGGTGGTGAGCCCTGCCGCTCGGACGCTTGCCCT …

Discina ancilis voucher H 673 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Discina ancilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈45 762 672 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Discina ancilis0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 746 records

Wild obs. + sensor1 344

Museum / vouchered390

Other12

Range

Area of Occupancy AOO5 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 564≤1 km 209≤10 km 355>10 km 48

1 176 georeferenced · 168 without coordinates

Open the mapobservation + sensor1 344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 24≤1 km 113≤10 km 101>10 km 10

248 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence390

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	136
Tartu, EE	32
WU-MYClocation not on record	22
Bernard Price Institute for Palaeontological Researchlocation not on record	16
Kuopio, FI	16
Pullman, US	12
Laramie, US	11
University of Tennessee at Chattanoogalocation not on record	10
Catholic University of Pekinglocation not on record	9
SLU Artdatabankenlocation not on record	9
Karlsruhe, DE	9
Ann Arbor, US	8
Denver, US	8
Philadelphia, US	7
Kew, GB	6
BDBClocation not on record	6
Cincinnati, US	5
Acadia Universitylocation not on record	5
Staten Island, US	5
Toronto, CA	5
Copenhagen, DK	3
Görlitz, DE	3
Bronx, US	2
GJOlocation not on record	2
WTUlocation not on record	2
Logan, US	2
PHlocation not on record	2
Madison, US	2
Turku, FI	1
FLASlocation not on record	1
Bardejov, SK	1
FAMCALlocation not on record	1
Burlington, US	1
Mlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Provincia di Livornolocation not on record	1
San Sebastián, ES	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
MAlocation not on record	1
TENN-Flocation not on record	1

40 institutions · 367 of 390 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Discina ancilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Mostly deciduous woods with an occasional re…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 14.6–14.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)19.9 °C 19.6–20.1

Min temp (night)9.60 °C

Precipitation96.3 mm/mo 91.8–101

Air humidity56.5 % 55.6–57.4

Moisture balance-27.5 mm/mo -33.7–-21.3

Vapour deficit728 Pa 715–742

Wind speed3.00 m/s 2.80–3.10

Cloud cover45.4 % 44.3–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Discina ancilis

At a glance

Sources10 archives

Compound class profile1 class

Documented compounds1 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 746 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 746 records