Disa inflexa

(Lindl.) Mundt ex Bolus · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Disa

At a glance

Occurrence records303

Data sources5

Biological traits15

DNA specimens0

eDNA detections1

Sources5 archives

Databases and archives Disa inflexa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF303 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Schizodium inflexum é uma espécie de orquídea geralmente terrestre pertencente à subtribo Disinae, endêmica da Província do Cabo Setentrional, na África do Sul. Apresentam raízes providas de tubérculos que originam caules flexíveis, delgados e resistentes que apresentam uma roseta de folhas na base e algumas folhas lineares ao longo de seu comprimento. A inflorescência não se ramifica e comporta poucas flores espaçadas ressupinadas, com sépala dorsal provida de calcar e pétalas de ápice dividido, com pequenos lobos basais e que apresentam profunda canaleta no centro, dando a impressão de estarem divididas. O labelo é pandurado, ou seja, em formato de violão, com três áreas claramente distintas, a extremidade aguda. A coluna tem apêndices laterais bem desenvolvidos, contém duas polínias e rostelo trilobado. Crescem solo arenoso bem drenado em meio aos arbustos nas encostas das montanhas. Nada se sabe sobre sua polinização, sua floração ocasionalmente ocorre após incêndios mas não está comprovada a ligação entre os eventos. Aparentemente este espécie é pouco ou nada cultivada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.34 m

Plant height min0.07 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 135 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disa inflexa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ414886.1 ↗827 bp

ACGT

GATCGCTGTGACGTGGGTGGTTCGCCGCCTTCGATACTGCAAGAAGTTCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Schizodium inflexum voucher Bytebier 2406 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type303 records

Wild obs. + sensor245

Museum / vouchered58

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 179≤1 km 10≤10 km 3>10 km 22

214 georeferenced · 31 without coordinates

Open the mapobservation + sensor245

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 58 records without

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	52
Cape Town, ZA	2
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
MeiseBGlocation not on record	2

4 institutions · 58 of 58 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Disa inflexa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)