Disa glandulosa

Burch. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Disa

At a glance

Occurrence records150

Data sources6

Biological traits15

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Disa glandulosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF150 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Disa glandulosa é uma espécie de orquídea geralmente terrestre pertencente à subtribo Disinae. Esta espécie é originária do Cabo Setentrional, na África do Sul. Trata-se de planta com raízes tuberosas vilosas de poucas ramificações e caule sem ramificações nem pilosidades, com folhas geralmente anuais, inflorescência também sem ramificações, flores de sépala dorsal galeada e pétalas oblongas, labelo sem calcar, e coluna sem apêndices proeminentes, com duas polínias.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.2 m

Plant height min0.05 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min600 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disa glandulosa has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAJ000120.1 ↗624 bp

ACGT

TCGAGACCCAAATAAGTTGGAGTGATTTGATAACCCGTGAATTATTATTGCAGCGCATACACTGGGCTGTGCACCTGTCCATCTATTGCA …

Disa glandulosa 5.8S rRNA gene and ITS 1 and ITS2 DNA

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type150 records

Wild obs. + sensor120

Museum / vouchered30

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 76≤1 km 9≤10 km 1>10 km 20

106 georeferenced · 14 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	10
Pretoria, ZA	9
Cape Town, ZA	3
Philadelphia, US	2
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
Claremont, US	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1
South Kensington, GB	1

8 institutions · 28 of 30 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Disa glandulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)