Disa gladioliflora

Burch. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Disa

At a glance

Occurrence records97

Data sources5

Biological traits15

DNA specimens0

eDNA detections2

Sources5 archives

Databases and archives Disa gladioliflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility97 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF97 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Disa gladioliflora é uma espécie de orquídea geralmente terrestre pertencente à subtribo Disinae. Esta espécie é originária do Cabo Setentrional, na África do Sul. Trata-se de planta com raízes tuberosas vilosas de poucas ramificações e caule sem ramificações nem pilosidades, com folhas geralmente anuais, inflorescência também sem ramificações, flores de sépala dorsal galeada e pétalas oblongas, labelo sem calcar, e coluna sem apêndices proeminentes, com duas polínias. É a espécie-tipo da seção Stenocarpa, formada por plantas de flores com calcar na sépala dorsal cujo comprimento é pelo menos igual ao comprimento da sépala. Existe uma subespécie denominada capricornis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.25 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 300 m

Elevation min750 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disa gladioliflora has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ891803.1 ↗758 bpSouth Africa · 2012

ACGT

AGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCAA …

Disa gladioliflora subsp. gladioliflora isolate DG12 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type97 records

Wild obs. + sensor64

Museum / vouchered33

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 49≤1 km 4≤10 km 3>10 km 4

60 georeferenced · 4 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	16
Pretoria, ZA	9
South Kensington, GB	3
Cape Town, ZA	2
MeiseBGlocation not on record	2

5 institutions · 32 of 33 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Disa gladioliflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)