Disa bracteata

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Disa

At a glance

Occurrence records8 103

Data sources6

Biological traits27

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Disa bracteata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF8 103 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Disa bracteata est une espèce de la famille des Orchidaceae. Elle est également connue sous le nom de bract disa, orchidée poireau d'Afrique du Sud.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length90 mm

Leaf width12.5 mm

Plant height0.4 m

Plant height max0.5 m

Plant height min0.2 m

Seed mass0.005 mg

Life cycle & reproduction5

Flowering timennnnnnnyyynn

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disa bracteata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences5

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAJ000117.1 ↗623 bp

ACGT

TCGAGACCCAAACGAGAGAGTGATTTGATAACTTGTGAATTATTATTGCAGCTAATCCTCATAGCTGTGCACCTGTCCATTTATGGCATG …

Monadenia bracteata 5.8S rRNA gene and ITS 1 and ITS2 DNA

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type8 103 records

Wild obs. + sensor7 596

Museum / vouchered498

Cultivated / captive9

Origin

Native4

Introduced2 240

Range

Area of Occupancy AOO12 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 4 924≤1 km 1 242≤10 km 180>10 km 216

6 562 georeferenced · 1 034 without coordinates

Open the mapobservation + sensor7 596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 62≤1 km 94≤10 km 119>10 km 10

285 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence498

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	99
Cape Town, ZA	89
Adelaide, AU	89
Museo Entomologico de Leonlocation not on record	53
Pretoria, ZA	50
Canberra, AU	35
Cape Town, ZA	29
Hobart, AU	20
Mount Annan, AU	5
Brisbane, AU	4
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	3
Bronx, US	2
Dresden, DE	1
Claremont, US	1
Christchurch, NZ	1
BGPAlocation not on record	1
La Trobe Universitylocation not on record	1

18 institutions · 487 of 498 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Disa bracteata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Disa bracteata

At a glance

Sources6 archives

Size & morphology6

Life cycle & reproduction5

Diet & foraging1

Habitat & environment12

Physiology & chemistry2

Other traits1

At a glance

Record type8 103 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type8 103 records