Disa bivalvata

(L.f.) T.Durand & Schinz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Disa

At a glance

Occurrence records673

Data sources6

Biological traits16

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Disa bivalvata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility673 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF673 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Disa bivalvata é uma espécie de orquídea geralmente terrestre pertencente à subtribo Disinae. Esta espécie é originária do Cabo Setentrional, na África do Sul. Trata-se de planta com raízes tuberosas vilosas de poucas ramificações e caule sem ramificações nem pilosidades, com folhas geralmente anuais, inflorescência também sem ramificações, flores de sépala dorsal galeada e pétalas oblongas, labelo sem calcar, e coluna sem apêndices proeminentes, com duas polínias.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.44 m

Plant height min0.1 m

Seed mass0.004 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disa bivalvata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ414862.1 ↗799 bp

ACGT

GATTGCTATGATGTTGGGTGGTTCGCCGCCTTCGATATAGCAAGAAGTTCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAA …

Disa bivalvata voucher Bytebier 2438 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type673 records

Wild obs. + sensor535

Museum / vouchered138

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 352≤1 km 15≤10 km 18>10 km 81

466 georeferenced · 69 without coordinates

Open the mapobservation + sensor535

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤1 km 7≤10 km 1

8 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	55
Pretoria, ZA	44
Cape Town, ZA	19
South Kensington, GB	7
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	4
MeiseBGlocation not on record	3
LDlocation not on record	2
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
Durban, ZA	1
Moscow State Universitylocation not on record	1

10 institutions · 137 of 138 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Disa bivalvata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)