Disa biflora

(L.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Disa

At a glance

Occurrence records172

Data sources5

Biological traits15

DNA specimens0

eDNA detections1

Sources5 archives

Databases and archives Disa biflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility172 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF172 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Schizodium cornutum é uma espécie de orquídea geralmente terrestre pertencente à subtribo Disinae, endêmica da Província do Cabo Setentrional, na África do Sul. Apresentam raízes providas de tubérculos que originam caules flexíveis, delgados e resistentes que apresentam uma roseta de folhas na base e algumas folhas lineares ao longo de seu comprimento. A inflorescência não se ramifica e comporta poucas flores espaçadas ressupinadas, com sépala dorsal provida de calcar e pétalas de ápice dividido, com pequenos lobos basais e que apresentam profunda canaleta no centro, dando a impressão de estarem divididas. O labelo é pandurado, ou seja, em formato de violão, com três áreas claramente distintas, a extremidade aguda. A coluna tem apêndices laterais bem desenvolvidos, contém duas polínias e rostelo trilobado. Crescem solo arenoso, em meio aos arbustos, em áreas mais secas próximos da praia. Nada se sabe sobre sua polinização, sua floração ocasionalmente ocorre após incêndios mas não está comprovada a ligação entre os eventos. Aparentemente este espécie é pouco ou nada cultivada..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.07 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max820 m

Elevation min90 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Disa biflora has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ414884.1 ↗827 bp

ACGT

GATCGCTGTGACGTGGGTGGTTCGCCGCCTTCGATACTGCAAGAAGTTCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Schizodium satyrioides voucher Bytebier 2379 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

07Deep time~1.27 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.27 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type172 records

Wild obs. + sensor144

Museum / vouchered28

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 104≤1 km 8≤10 km 4>10 km 11

127 georeferenced · 17 without coordinates

Open the mapobservation + sensor144

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	20
MeiseBGlocation not on record	2
WAGlocation not on record	2
Saint Louis, US	2
Moscow State Universitylocation not on record	1
Universität Tübingenlocation not on record	1

6 institutions · 28 of 28 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Disa biflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)