Dirina ceratoniae

(Ach.) Fr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Arthoniomycetes/Arthoniales/Roccellaceae/Dirina

At a glance

Occurrence records548

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Dirina ceratoniae's data was compiled from.

GBIFGlobal Biodiversity Information Facility548 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF548 records

Environmental DNA1 datasets · 0 countries14 detections

DNA & barcodingBOLD · NCBI14 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dirina ceratoniae has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes1

GenBank sequences10

eDNA detections14

Countries5

The DNA barcodea real sequence read deposited for this species

ITSKC107888.1 ↗576 bpFrance · 2011

ACGT

ATTAGAGAAAGGGTCTTAACGGGCCCGACCTCCCACCCTCTGCCTATTTAACATTGTTGCTTTGGCGGTGCGCCGGGTACTTATCGTGCG …

Dirina ceratoniae bio-material Damien Ertz 16367 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type548 records

Wild obs. + sensor95

Museum / vouchered373

Other80

Origin

Native59

Range

Area of Occupancy AOO820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 3≤1 km 58≤10 km 8

69 georeferenced · 26 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 3≤1 km 26≤10 km 49>10 km 3

81 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence373

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	151
Stockholm, SE	38
Barcelona, ES	27
Berlin, DE	26
TSBlocation not on record	22
València, ES	19
MeiseBGlocation not on record	13
Madison, US	12
Museo Achille Folettolocation not on record	11
ASUlocation not on record	9
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	8
Madrid, ES	7
Durham, US	5
US	5
CLUlocation not on record	4
Chicago, US	2
Mus�e des Confluenceslocation not on record	2
St. Paul, US	2
BClocation not on record	2
University of Gdansklocation not on record	1
San Sebastián, ES	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
MAlocation not on record	1
Olocation not on record	1
University of Hamburglocation not on record	1
Edinburgh, GB	1

26 institutions · 372 of 373 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Dirina ceratoniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)