Dirca occidentalis

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Dirca

At a glance

Occurrence records1 556

Data sources11

Biological traits20

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Dirca occidentalis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS · NPASS60 compounds

Occurrence & distributionGBIF1 556 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dirca occidentalis, the western leatherwood, is a deciduous shrub with leaves three to seven centimeters in length. Yellow flowers emerge prior to leafing. It grows on moist and shaded slopes. It is rare and endemic to the San Francisco Bay area of California. Its closest relative, Dirca palustris, lives in the eastern half of North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height2 m

Seed mass11.98 mg

⚠ sources differ — TRY: 11.98 mg · GIFT: 11.38 mg

Seed mass max11.38 mg

Seed mass min11.38 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry5

Leaf n24.7 mg/g

Leaf p1.73 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)18.73 mm²/mg

Wood density327 mg/cm³

03Chemical composition60 compounds

Compounds documented for Dirca occidentalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids9

Oleanane triterpenoids7

Daphnane diterpenoids4

Gallotannins4

Dimeric phloroglucinols3

Documented compounds60 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Betulonic acid	present	NPASS
(+)-lariciresinol	present	LOTUS
(+)-Syringaresinol	present	LOTUS
(-)-Lariciresinol	present	LOTUS
(-)-Medioresinol	present	LOTUS
(14S,15R,19R)-14-[(10R,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione	present	NPASS
(14S,15S,19S)-14-[(10S,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione	present	NPASS
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
(1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(3S,4aR,6aR,6bS,8aR,11R,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a,14,14a-tetradecahydro-1H-picen-3-ol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dirca occidentalis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF963930.1 ↗696 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCATAGCAGAACAACTCGTGAACTTGTAAGCATAA …

Dirca occidentalis isolate CBP193 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dirca occidentalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · book-ipcn65

CCDB · book-ipcn65 — Stebbins & M. 1965

08Occurrence & distribution

Record type1 556 records

Wild obs. + sensor1 323

Museum / vouchered233

Origin

Native34

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 772≤1 km 69≤10 km 26>10 km 143

1 010 georeferenced · 313 without coordinates

Open the mapobservation + sensor1 323

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 7≤1 km 71≤10 km 115>10 km 6

199 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence233

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	68
Claremont, US	35
Davis, US	10
Santa Barbara, US	7
San Luis Obispo, US	6
Wuzhou, CN	5
Saint Louis, US	5
San Jose, US	4
Arcata, US	4
Riverside, US	4
Los Angeles, US	4
US	3
Canadian Department of Agriculturelocation not on record	3
Denver, US	2
San Diego, US	2
University of Stellenboschlocation not on record	2
Chongqing Museumlocation not on record	2
Cambridge, US	2
Cambridge, US	1
West Virginia Wesleyan Collegelocation not on record	1
Logan, US	1
Boise, US	1
New Haven, US	1
Davenport, US	1
Corvallis, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Northridge, US	1

27 institutions · 177 of 233 vouchered records shown · 56 without an institution code

09Environmental DNA1 detections

Where the DNA of Dirca occidentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dirca occidentalis

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Physiology & chemistry5

Compound class profile5 classes

Documented compounds60 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 556 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 556 records