Dipturus innominatus

(Garrick & Paul, 1974) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rajiformes/Rajidae/Dipturus

At a glance

Occurrence records8 528

Data sources9

Biological traits12

DNA specimens32

eDNA detections32

Sources9 archives

Databases and archives Dipturus innominatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 268 records↗

OBISOcean Biodiversity Information System4 260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF · OBIS8 528 records

Environmental DNA1 datasets · 1 countries32 detections

DNA & barcodingBOLD32 specimens

01Narrative

The New Zealand smooth skate (Dipturus innominatus) is a skate of the genus Dipturus, found around New Zealand at depths between 15 and 1,300 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology1

Body length240 cm

Life cycle & reproduction4

Age at maturity (male)2 920 days

Age at sexual maturity4 745 days

Litter size38

Max. longevity288 months

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits4

Depth max1 310 m

Depth min15 m

Interbirth interval365 days

Vulnerability79.7

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dipturus innominatus has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 4 variable positions, in barcode order

46Gmostly conserved

277Cmostly conserved

331Cmostly conserved

409Gmostly conserved

CCTTTACTTAATTTTTGGCGCCTGAGCAGGCATGGTCGGGACTGGGCTAAGTCTTTTAATCCGAGCAGAACTAAGTCAACCCGGGACTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dipturus gudgerisame genus2.0%Dipturus canutussame genus2.6%Dentiraja cervasame family3.5%Dentiraja confusasame family3.8%Dentiraja healdisame family3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_037962 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type8 528 records

Wild obs. + sensor8 501

Museum / vouchered27

Range

Area of Occupancy AOO14 556 km²

Depth

0–200 m sunlit1 805

200–1000 m twilight2 309

1–4 km midnight47

>4 km abyssal0

median 302 m · max 1 444.5 m · 4 161 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7 536≤1 km 954>10 km 11

8 501 georeferenced

Open the mapobservation + sensor8 501

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 12

17 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	10
Auckland, NZ	2

2 institutions · 12 of 27 vouchered records shown · 1 without an institution code

09Environmental DNA32 detections

Where the DNA of Dipturus innominatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 5.70–11.5

Seasonal swing summer↔winter6.30 °C

Max temp (day)12.6 °C 9.20–12.7

Min temp (night)10.3 °C 1.40–10.4

Precipitation44.7 mm/mo 43.3–130

Air humidity62.4 % 62.0–62.8

Vapour deficit515 Pa 357–520

Cloud cover37.8 % 37.1–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dipturus innominatus

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction4

Habitat & environment2

Uses & economy1

Other traits4

At a glance

Record type8 528 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 528 records