Diplotoxa versicolor

(Loew, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Chloropidae/Diplotoxa

At a glance

Occurrence records93

Data sources7

Biological traits0

DNA specimens77

eDNA detections102

Sources7 archives

Databases and archives Diplotoxa versicolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI102 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF93 records

Environmental DNA1 datasets · 1 countries102 detections

DNA & barcodingBOLD77 specimens

01Narrative

Diplotoxa versicolor is a species of grass fly in the family Chloropidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplotoxa versicolor has left across the world's sequence archives.

At a glance

DNA specimens77

BINs1

Marker genes1

eDNA detections102

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

76Amostly conserved

82Cvariable

89Gmostly conserved

154Cmostly conserved

172Tmostly conserved

200Gvariable

217Avariable

263Tvariable

271Tmostly conserved

313Cvariable

316Amostly conserved

318Cmostly conserved

335Gmostly conserved

343Avariable

346Tmostly conserved

347Cvariable

349Tvariable

368Gvariable

374Gmostly conserved

386Cvariable

494Amostly conserved

496Avariable

508Amostly conserved

519Cmostly conserved

562Tmostly conserved

569Amostly conserved

570Tmostly conserved

573Cmostly conserved

576Tmostly conserved

577Amostly conserved

578Tmostly conserved

584Amostly conserved

585Cmostly conserved

586Tvariable

587Gmostly conserved

588Amostly conserved

590Cmostly conserved

591Gmostly conserved

592Amostly conserved

593Amostly conserved

594Amostly conserved

595Tmostly conserved

AACATTATATTTTATATTTGGAGCATGAGCTGGAATAGTGGGAACTTCTTTAAGAATTTTAATTCGAGCAGAATTAGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes10

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplotoxa messoriasame genus4.0%Diplotoxa diplotoxoidessame genus5.5%Pseudopachychaeta approximatonervissame family7.8%Pseudopachychaeta ruficepssame family7.9%Thaumatomyia pullasame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type93 records

Wild obs. + sensor2

Museum / vouchered91

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤10 km 12

13 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Cleveland Museum of Natural History, OH (CLEV)location not on record	20
Essig Museum of Entomologylocation not on record	13
Universidad Católica de Manizaleslocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3

4 institutions · 42 of 91 vouchered records shown · 49 without an institution code

09Environmental DNA102 detections

Where the DNA of Diplotoxa versicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found102

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 102 detections have coordinates

Open the map1 country0

Forest5. Wetlands (inland)Grassland4. Native GrasslandWetlandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 14.1–19.9

Seasonal swing summer↔winter23.2 °C

Max temp (day)23.2 °C 18.9–27.2

Min temp (night)10.8 °C 8.30–14.8

Precipitation66.3 mm/mo 29.6–144

Air humidity52.6 % 51.2–59.8

Moisture balance-63.6 mm/mo -117–3.20

Vapour deficit882 Pa 664–1,109

Wind speed2.50 m/s 2.40–3.90

Cloud cover33.4 % 31.4–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 102 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)