Diplotaxis sordida

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Diplotaxis

At a glance

Occurrence records420

Data sources5

Biological traits0

DNA specimens7

eDNA detections7

Sources5 archives

Databases and archives Diplotaxis sordida's data was compiled from.

GBIFGlobal Biodiversity Information Facility420 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF420 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplotaxis sordida has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes2

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

50Tvariable

205Tvariable

223Cvariable

232Tvariable

235Cvariable

265Gvariable

274Avariable

283Avariable

316Avariable

379Tvariable

407Cvariable

415Gvariable

478Gvariable

523Avariable

529Cvariable

547Cvariable

550Cvariable

565Avariable

AACTTTATACTTTTTATTCGGAAGATGAGCAGGCATAGTTGGAACCTCATTAAGACTCCTAATTCGAGCAGAATTAGGAAATCCCGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes3

BINs2

Most divergent pair2.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplotaxis lengiisame genus11.7%Diplotaxis libertasame genus12.2%Diplotaxis brevicollissame genus14.1%Diplotaxis sierraesame genus14.4%Diplotaxis subcostatasame genus15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type420 records

Wild obs. + sensor45

Museum / vouchered375

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 26≤1 km 5≤10 km 2>10 km 1

34 georeferenced · 11 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 52≤1 km 226≤10 km 18

296 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	281
North Carolina State University Insect Museumlocation not on record	27
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	24
WIlocation not on record	10
University Park, US	10
University of Guelphlocation not on record	6
OSUClocation not on record	6
ASUlocation not on record	4
Espace pour la vielocation not on record	3
Museo Entomologico de Leonlocation not on record	1
CUlocation not on record	1
Awka, NG	1
UDlocation not on record	1

13 institutions · 375 of 375 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Diplotaxis sordida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Red oak-white pine forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 13.3–14.9

Seasonal swing summer↔winter34.5 °C

Max temp (day)19.2 °C 17.5–20.8

Min temp (night)9.00 °C 8.60–9.40

Precipitation133 mm/mo 89.5–176

Air humidity58.4 % 56.4–60.4

Moisture balance21.5 mm/mo -29.6–72.5

Vapour deficit674 Pa 606–741

Wind speed2.50 m/s 2.50–2.60

Cloud cover50.0 % 48.2–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)