Diplostyla concolor
(Wider, 1834) · speciesAt a glance
Occurrence records25 433
Data sources9
Biological traits60
DNA specimens199
eDNA detections221
Sources9 archives
Databases and archives Diplostyla concolor's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility25 433 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI221 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics199 specimens↗
World Spider Trait DBMasaryk University60 traits · 33 refs↗
World Spider CatalogNaturhist. Museum Bernworld catalog↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements33 literature sources60 traits
Occurrence & distributionGBIF25 433 records
Environmental DNA4 datasets · 12 countries221 detections
DNA & barcodingBOLD199 specimens
01Narrative
Diplostyla is a monotypic genus of dwarf spiders containing the single species, Diplostyla concolor. It was first described by James Henry Emerton in 1882, and has only been found in Russia, and Turkey.
No narrative description available for this taxon yet.
02Traits & measurements
Compiled from 33 sources
Wolff et al. 2022Pekár 2014aSchirmel et al. 2012Birkhofer et al. 2017Simonneau et al. 2016Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Hyvärinen et al. 2019Bruun & Lissner 2019SLU 2020Gajdoš et al. 2014Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Řezáč et al. 2015Blick & Scheidler 2004Finch 2004Kielhorn 2017Blick et al. 2016Maelfait et al. 1998Blackwall 1864Danisman & Cosar 2013Emerton 1882Nentwig et al. 2018Cardoso et al. 2011Pekár et al. 2012a
Morphometry42
ALE0.06 mm
AME0.04 mm
Abdomen height1.51 mm
Abdomen length1.58 mm
Abdomen width1.19 mm
Body length♀2.67·♂2.75 mm
Cephalothorax height0.382 mm
Cephalothorax length0.955 mm
Cephalothorax width0.83 mm
Chelicerae basal part (paturon) length0.44 mm
Fang length0.258 mm
Femur I length1.02 mm
Femur I width0.18 mm
Femur II length1.07 mm
Femur III length0.73 mm
Femur IV length1.16 mm
Femur IV width0.14 mm
Leg I length3.88 mm
Leg II length3.77 mm
Leg III length2.96 mm
Leg IV length4.19 mm
Metatarsus I length0.89 mm
Metatarsus II length0.79 mm
Metatarsus III length0.62 mm
Metatarsus IV length1.0 mm
PLE0.065 mm
PME0.06 mm
Patella I length0.26 mm
Patella II length0.25 mm
Patella III length0.27 mm
Patella IV length0.27 mm
Spinneret PLS0.08 mm
Tarsus I length0.62 mm
Tarsus II length0.5 mm
Tarsus III length0.58 mm
Tarsus IV length0.62 mm
Tibia I length1.09 mm
Tibia I width0.1 mm
Tibia II length1.06 mm
Tibia III length0.76 mm
Tibia IV length1.13 mm
Tibia IV width0.075 mm
Predation6
Hunting guildsheet web weavers
Hunting guild 2aerial web builder
Prey diversity4 mm
Simple hunting guild IIweb
Simple hunting guild classificationcursorial
Web buildingyes
Ecology9
Ballooningvery common
Circadian activity0.5 mm
Light0.625 mm
Light 2shaded
Moisture 10.625 mm
Moisture 2humid
Regional IUCN Red List categoryLeast Concern (LC)
Regional non-IUCN Red List categoryLeast Concern (*)
Stratum0 mm
Biomechanics1
'Primary mode of locomotionhanging
Defence1
Retreatcrevice
Morphology1
Cribellumabsent
05DNA & barcoding199 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplostyla concolor has left across the world's sequence archives.
At a glance
DNA specimens199
BINs1
Marker genes1
eDNA detections221
Countries15
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus169 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.
Where individuals differ — all 9 variable positions, in barcode order
202Tvariable
263Cmostly conserved
287Tvariable
293Avariable
340Cmostly conserved
367Cmostly conserved
511Avariable
517Avariable
592Gmostly conserved
AACTTTATATTTAATTTTTGGGGCTTGATCTGCTATAGTGGGAACGGCTATAAGAGTATTAATTCGAATTGAGTTAGGTCAAACAGGTAG …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)0.61%
Haplotypes17
BIN1
Most divergent pair1.8%
N.AmericaEurope
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P
animal barcode
08Occurrence & distribution
Record type25 433 records
Wild obs. + sensor16 894
Museum / vouchered8 349
Cultivated / captive30
Other160
Origin
Native5 268
Introduced1
Range
Area of Occupancy AOO14 144 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy17% within 1 km
≤100 m 1 945≤1 km 791≤10 km 13 007>10 km 134
15 877 georeferenced · 1 017 without coordinates
Open the mapobservation + sensor16 894
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy15% within 1 km
≤100 m 273≤1 km 510≤10 km 4 203>10 km 280
5 266 georeferenced · 3 083 without coordinates
Open the institutions mapphysical evidence8 349
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 30 records without
Open the mapnot free-living30
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions21 of 63 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brussels, BE | 1 585 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 315 |
| Helsinki, FI | 965 |
| 345 | |
| Adam Mickiewicz University in Poznańlocation not on record | 330 |
| Paro, BT | 279 |
| Chicago, US | 93 |
| Musee d'Histoire Naturallelocation not on record | 77 |
| University of Guelph, Centre for Biodiversity Genomicslocation not on record | 66 |
| Copenhagen, DK | 58 |
| Bonn, DE | 52 |
| Cambridge, US | 51 |
| Ekaterinburg, RU | 51 |
| Ohio State University Acarology Laboratorylocation not on record | 50 |
| Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record | 50 |
| Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record | 46 |
| Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record | 37 |
| Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record | 33 |
| Frankfurt am Main | 30 |
| Denver, US | 27 |
| Ghent, BE | 26 |
| SLU Artdatabankenlocation not on record | 24 |
| Tilburg, NL | 23 |
| Zoologisches Museum Hamburglocation not on record | 21 |
| Provincia di Livornolocation not on record | 17 |
| Royal Ontario Museumlocation not on record | 17 |
| Tartu, EE | 16 |
| SNSDlocation not on record | 16 |
| SNSB-Zoologische Staatssammlung Münchenlocation not on record | 14 |
| ARTlocation not on record | 14 |
| NTNU-VMlocation not on record | 13 |
| Metsähallituslocation not on record | 13 |
| Uniwersytet w Białymstokulocation not on record | 13 |
| Akademia Pomorska w Słupskulocation not on record | 13 |
| Bern, CH | 12 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 10 |
| University of Tokyo, Department of Zoologylocation not on record | 9 |
| Royal Museum for Central Africalocation not on record | 9 |
| Geneva, CH | 7 |
| Uniwersytet Łódzkilocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Saint John, CA | 5 |
| SGAV-and-NHMDlocation not on record | 5 |
| LEBAlocation not on record | 4 |
| University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record | 4 |
| Washington, US | 3 |
| BioFokuslocation not on record | 3 |
| Natural History Museum, Londonlocation not on record | 2 |
| Bavarian State Collection of Zoologylocation not on record | 2 |
| Midt-Troms Museumlocation not on record | 2 |
| EIBElocation not on record | 2 |
| Albuquerque, US | 2 |
| ZSMlocation not on record | 2 |
| neflocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Institute of Plant and Animal Ecology (IPAE)location not on record | 1 |
| UAclocation not on record | 1 |
| University of Guelphlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| MZLUlocation not on record | 1 |
| Buenos Aires, AR | 1 |
| Rovaniemi, FI | 1 |
| Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record | 1 |
63 institutions · 5 887 of 8 349 vouchered records shown · 2 461 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA221 detections
Where the DNA of Diplostyla concolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found221
Studies independent surveys4
Countries12
Verifiable raw sequence linked32
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 221 detections have coordinates
Open the map12 countries0
grasslandStreuobstwieseUrban yard, in brick pileParkprairieWirtschaftswald
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.6 °C 3.80–21.7
Seasonal swing summer↔winter25.2 °C
Max temp (day)18.2 °C 7.20–24.2
Min temp (night)10.2 °C 1.20–19.2
Precipitation75.6 mm/mo 40.2–102
Air humidity60.0 % 57.6–65.8
Moisture balance-10.2 mm/mo -90.1–49.1
Vapour deficit586 Pa 302–1,086
Wind speed3.20 m/s 2.40–6.10
Cloud cover45.2 % 38.8–58.1
CHELSA 1981–2010, ~9 km grid, at location & month of 216 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.