Diplonevra nitidula

(Meigen, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Phoridae/Diplonevra

At a glance

Occurrence records2 978

Data sources7

Biological traits0

DNA specimens3 450

eDNA detections5 375

Sources7 archives

Databases and archives Diplonevra nitidula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 978 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 375 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 450 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 978 records

Environmental DNA5 datasets · 16 countries5 375 detections

DNA & barcodingBOLD3 450 specimens

01Narrative

Diplonevra nitidula is a species of scuttle flies (insects in the family Phoridae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 450 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplonevra nitidula has left across the world's sequence archives.

At a glance

DNA specimens3 450

BINs1

Marker genes2

eDNA detections5 375

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus3 000 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

79Amostly conserved

328Amostly conserved

469Amostly conserved

AACTTTATATTTTATTTTTGGAGCATGAGCCGGAATAGTAGGAACATCATTAAGAATTATAATTCGTGCTGAATTAGGACACCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 54 variants.

Diversity (π)0.73%

Haplotypes54

BIN1

Most divergent pair6.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplonevra glabrasame genus7.7%Diplonevra funebrissame genus7.8%Diplonevra pilosellasame genus7.8%Diplonevra freyisame genus7.8%Diplonevra concinnasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 978 records

Wild obs. + sensor228

Museum / vouchered2 747

Cultivated / captive3

Origin

Native35

Range

Area of Occupancy AOO1 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 118≤1 km 36≤10 km 60

214 georeferenced · 14 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 162≤1 km 39≤10 km 27>10 km 1

229 georeferenced · 2 518 without coordinates

Open the institutions mapphysical evidence2 747

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1 011
NTNU-VMlocation not on record	122
University of Guelphlocation not on record	74
MZLUlocation not on record	65
Los Angeles, US	35
Helsinki, FI	3
SGAV-and-NHMDlocation not on record	2
Stockholm, SE	2
Metsähallituslocation not on record	2
Tilburg, NL	1
Natural History Museum, Londonlocation not on record	1

11 institutions · 1 318 of 2 747 vouchered records shown · 1 429 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 375 detections

Where the DNA of Diplonevra nitidula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5 375

Studies independent surveys5

Countries16

Verifiable raw sequence linked1 753

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 375 detections have coordinates

Open the map16 countries0

GrasslandMixed habitat1. Forest & Woodland|1.1 Boreal ForestGarden lawnFarmland, coast and birch habitatDeichvorland und Deich

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.8–20.4

Seasonal swing summer↔winter21.8 °C

Max temp (day)20.2 °C 15.1–25.2

Min temp (night)12.8 °C 8.20–16.1

Precipitation81.0 mm/mo 56.0–101

Air humidity60.3 % 57.6–63.6

Moisture balance-34.9 mm/mo -66.1–27.5

Vapour deficit710 Pa 521–1,003

Wind speed3.30 m/s 2.40–4.50

Cloud cover43.8 % 38.7–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 368 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplonevra nitidula

At a glance

Sources7 archives

At a glance

Record type2 978 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 11 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 978 records