Diplomitoporus flavescens

(Bres.) Domański · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Diplomitoporus

At a glance

Occurrence records1 271

Data sources9

Biological traits0

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Diplomitoporus flavescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 271 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Diplomitoporus flavescens is a species of poroid crust fungus in the family Polyporaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplomitoporus flavescens has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOL470308.1 ↗462 bp

ACGT

GCGCAGGTGACTGCGGAGACATTATTGAATTTTAATGGACGGGGTTGTCGCTGGCCTGTCTCAGGCATGTGCACGCCTTGCTTCATCCAA …

Diplomitoporus flavescens voucher Dai 19244 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 271 records

Wild obs. + sensor1 013

Museum / vouchered258

Range

Area of Occupancy AOO2 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 140≤1 km 26≤10 km 610>10 km 13

789 georeferenced · 224 without coordinates

Open the mapobservation + sensor1 013

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 13≤1 km 16≤10 km 33>10 km 10

72 georeferenced · 186 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	45
Tartu, EE	36
Olocation not on record	19
Görlitz, DE	19
Karlsruhe, DE	16
SLU Artdatabankenlocation not on record	9
Uppsala, SE	9
Copenhagen, DK	9
WU-MYClocation not on record	6
Uniwersytet Łódzkilocation not on record	5
Mlocation not on record	4
BRNUlocation not on record	3
University of the Basque Country (UPV/EHU)location not on record	3
Göteborg, SE	3
Kew, GB	2
Zürich, CH	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
UNINE:NEUlocation not on record	2
BioFokuslocation not on record	2
San Sebastián, ES	2
Jyväskylä, FI	2
Stockholm, SE	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Warsaw, PL	1
TROMlocation not on record	1
Trondheim, NO	1
BDBClocation not on record	1

27 institutions · 206 of 258 vouchered records shown · 51 without an institution code

09Environmental DNA4 detections

Where the DNA of Diplomitoporus flavescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplomitoporus flavescens

At a glance

Sources9 archives

At a glance

Record type1 271 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 271 records