Diplomitoporus crustulinus

(Bres.) Domański · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Diplomitoporus

At a glance

Occurrence records1 243

Data sources9

Biological traits0

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Diplomitoporus crustulinus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 243 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Diplomitoporus crustulinus is a species of fungus belonging to the family Polyporaceae. It is native to Eurasia and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplomitoporus crustulinus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAF343320.1 ↗594 bp

ACGT

GGCCGGGGTTGTCGCTGGCCTGACTCAGGCATGTGCACACCTTGCTTCATCCAATTCTCAACCTCTGTGCACCTTTCATGGGCTGGTTGG …

Diplomitoporus crustulinus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type1 243 records

Wild obs. + sensor978

Museum / vouchered265

Range

Area of Occupancy AOO3 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 738≤1 km 164≤10 km 29>10 km 8

939 georeferenced · 39 without coordinates

Open the mapobservation + sensor978

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 104≤1 km 33≤10 km 47>10 km 7

191 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence265

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	101
SLU Artdatabankenlocation not on record	58
Uppsala, SE	19
Joensuu, FI	9
Umeå Universitylocation not on record	9
BioFokuslocation not on record	6
Bronx, US	6
Jyväskylä, FI	4
Trondheim, NO	4
Stockholm, SE	3
Tartu, EE	2
Göteborg, SE	2
Mexico City, MX	1
Acadia Universitylocation not on record	1
GJOlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Toronto, CA	1
IB FRC Komi SC UB RASlocation not on record	1
St. Paul, US	1
nsnflocation not on record	1
Copenhagen, DK	1

21 institutions · 232 of 265 vouchered records shown · 32 without an institution code

09Environmental DNA1 detections

Where the DNA of Diplomitoporus crustulinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.50 °C 2.50–2.50

Seasonal swing summer↔winter26.2 °C

Max temp (day)5.20 °C

Min temp (night)-0.7 °C

Precipitation61.0 mm/mo

Air humidity65.4 %

Moisture balance16.0 mm/mo

Vapour deficit330 Pa

Wind speed2.80 m/s

Cloud cover52.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplomitoporus crustulinus

At a glance

Sources9 archives

At a glance

Record type1 243 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 243 records